Vienna Tile Information
VT ID VT057280
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200916
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 257280
Nearest Genes
Gene Nr FlyBase ID Distance
CG16752 FBgn0029768 1883 bp
CG15784 FBgn0029766 11970 bp
Sequence Length 2131
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGTTAATAGGAACTGCAGAACGTGAACA
Right Primer CTTGCAGGCGCAATTTTCAATGCAG
Template genomic
Sequence CGTTAATAGG AACTGCAGAA CGTGAACAAT AAAATTGTAT GGATTTTGTA TTCGCATAAG CTACCATGAA TCACTTGCTT ATCTGGTTGG AATTTACTTA TTTTTTTTAT TTTTTTATTT TTTTTTCCGA GCACAAGTTG CAACTTTTAG TGCAACACAG TGAGGCAACG CAAAAGCGGA AGCGAATGCG CCCTTCTTTT ATGCCCGACA AATTCGTATG CCATCTATAT AATTTGTAAG TGTGTTGTGT GTGTGTGGGT GTGTGGGTGT GGGTTTGTAA GGGGGGGGAG GGGCTGGTCC CATGTGGAGC TGTGCTTGTG GTCCTCCGTG GGATATTGGC ACGCACACAG CATAAGCAAA TGCATAACGA GACCACACAC ATTCGCACAT TCACGCACAC ACACACGCAC ACATAACAAT AACCGAGATA ACTAATAGCA AATTGCTGGC ATCGTTCACT TCACGGCCCC CTCTGCCATT TGCCATTTTC CGAGGAATTT CCTCGTGGCT GGGAGCTGAT GTACTGCAAT CTTGAGAGCA AGTATTTATA ACACACACAC ACACGCACAC CCTGCGTTTT GCCACTCCTA ATTACTGTCA CTGCTGTGGT AATCATGATT TAAGCGCTAA TCTGTCCCTG TGCGCGCACA TAGGGGCGAA TGGGGTTAAC CGGAAACGGA AGTGAAAATA AATTCACACG TCAGGAATAT CACTTGCTGC AGAAATAACT GAGTATTTCC AGTGAGGCAA AGGATTCAAA GTGATGAAAG CATTCCAACC AAAAAAAAAA GTAAAGGGTA AAGGGTAGCA CATCGAAGCG CGCAAAAAGC GTTTAAAGCA AATATGTTGA ATTCAATTTG TAGAGCACAC ACAATCGCAA ACACCTTAAG AATGCCCCCA GGGGGCTTAG TGTGTGTGTG TGTGCGTGTG TGTGTGTGTG TAAGTACATC AAGAGAAAAC GGGGGTGATG GGTGGACGGG CGGCGCACTT GTTTGTTGGC TTGTCAAAGA AATACCAATA CGACAAGCAC ACGCACTTCC GCCTCGAGAC CCCAAAAGCC ACCGAAATTG AATTGTGGAT GGGAAAGTGA TTGGTGAACA AACGCAGAGG GGAAGAAGTA TATTTCAAGT TTTATTGCAT TTTATCCTTG GGAATGTTAT TAAGCTATAC AATTATTTCA GTTATATTCA GATGATTCAG ATGATTAATT GCAATTTAAT AACCAATTGA AGCAACGTAG TCAATTATTG TATATAAATA TTAATGCAGT GATTATTCAT AAGGATTGTT AAAAGTTAAT TTCTGCATAC GCAATAAGCT GCATGTCCAA TAAATAATTG TGAGCGGTCA AATGAGAGAG TTTTTAATGG CGATATCGTG TGCCATTAAA CAATTGAATG CTGAGCCAAT TGAAACACCG AATCCTCGTT GAAAGTCATG ACTGGTTTTT AAAAAGGGCA TTTAAAGTGG CTGAAAGATT CATCACTCGT TATTTGCGGC ATACGTCCGT TCGACTCTAT GTTCGGTTTG CAATCGGATT AACCTTGGAC ACCTTGACAT GCTTTATGCA CCCCCAGGAC ATACAGGATT CTCTCGATTC TCTGGTTTCT CAGAACTGTG GCGATTCTAC AGCGAAACCC CTGAGGCATA TCAATCACTC GGAGCCTTTG TGCTGACCAA ATTCTATGAA ATTGAAATCG AAATCAACTG TCTTGCATGC ACTACTCAGT AGTTTGTCGG TATACGGGTA TGATGGGCCC AAATGAGTTG GGTAAACAAA GTTACAGCAC AAGTAATATA ATCAGGTTTT TAAAGTCCTA TGGGAGAAGT CATCAAACGT ATGCTCATAT GAGCAGTTGG AATCCCTTCT GCTTCACATA TTATTTGACT TTCCTTTCAC TTCTTTGATC TTGCGAGAAA TTGTGCTGCG TTTTTGTTCT GGTATTTCCC TGTCGCCATA CTTGCCAGCT CAGCTCGTTT TTGTTTCTGT GGCTTTCGTT GTCCTGGACA GGACTTCCGG TCCGGACCGT TCTGCCCACG CCCCAGGCAG GAGCGCAAAA ATGCAATTAT AATCCCAGTG GCAGCAGGCG GCAACTGGCA GTGCAACTGC ATTGAAAATT GCGCCTGCAA G