Vienna Tile Information
VT ID VT025925
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200883
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225925
Nearest Genes
Gene Nr FlyBase ID Distance
CG32423 FBgn0052423 44900 bp
Sequence Length 2130
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GAGCTGAAATCCATTTGGCAACAGC
Right Primer AACTCCTCCTGTCCTGTGTGGACCC
Template genomic
Sequence GAGCTGAAAT CCATTTGGCA ACAGCTGCTT CTAGCACATA GACGGCTGAA AAGCATACAA CCTTCGAGGA ACTAACAATG TAAGAGGCAT CAGCTTTGTA AAGTGTGTCA TAAAATCAGG TCTAAAACTA ACGAATCATA TATTAAATAG GCATTTTAAG CAGCAGACAA TGCTGAACAA TGCGGCGTAT ACGCAATATT GAGTGTCACC CCAGGCATTC GTTCAAGCAG TTTTCGCCAC TTAAATCGGC CAGATGACGA TGATAATAAT GCAACCAGAA GCAGCACAGA AAAAAAAAAC CATAGAATTC TCCTGTACTT AAGAACATGT ATGGCCGAGG AACTCGACAT ATGCCAAGCC GAGGCAGCTG GTGGAGGTGG CATTCCAACA GGAAGGGAAT TCAAGCCATG CCCACCACTT CACATAGAGT TCGACCGACT CAACTTTGAC ATTTCTCTCT CTCACTCGGA CTGCCTCGAA TTCTGCCGCC CTGCTGTTTT TTCCCCAACA CCATTCCACC CACGGTCATT TTCCTGGCAC ACACAATGGT ATGTCCACGG CATGTGGCAG TCAGATGTGT GGGCGTGGCG TTCAACTTGT TTTTGCCGCA AAATGATTTA TGACAATGCA TTGAAAAGTT CGTTCTAGGC TGTCAACAAG GGAGGGGAAA TGTCAATAAG GGAACCCAGC TAGACCAGAG GCGATAGAAT TGTAAGAAGG CAAGTCCTTA GAAGCATAAA TGTACACAGG GAAAAATATA AATATTTCAT AAAGATACCA TAGAGATCCT TGGGCTGGGA AATGTGCTCT TATCAACACA TTTCGTGACC TTTTTTTTAA GTGCGTTTCA ATCTATTAAA TTGATAGCCA TCTCTGCTTC GCAGCTAACC ATTTTTATCT GATTTTCAAT TTGCAGCTAG AAACTGTTTA AGGCCTTAAA TGTAGAAGCA AAATGTCAGG GTAGCAGGCA GCCAAATGCC AATAAGTTGT CATGTTCCGA CGACAGCTGC AGCATCTCGC ACATCCTGGC ACATCCTGCT CCTGTCGCAT CCACACACAT CTATATATCC TTCCCTTTTG CCGGGGGCCA CTTACACTTA CACGTTCGTC GGGAATGGCC AAAGACTGCG GGCTCCGTCT TACTCCGACT ACATTCACAC ACATTATTCA GGGATGCAGT GGGTAAATGG GCTAGTCTAG GACGTTTCTT GTTGGAAAAA GAGTCCTGTC TTGACGCCTG AGCACGTCCC TCATATGCCA CAAGAAGCTG CACACGCTGA CACATTAATG TCCGCAGCGG TATATCCTGT CGCACCTGTC CTTGCCCACC TGTATATTCT ACGGCTGAAA AACCCTCAAA ACTATCCCAC CATTTCCGCT GCCATCGCTG CCATTGTCGT ATTTGTCTTA TGAACTGTCA AACTGACATT CATTGACGCT TGACGTGTAA TAAACGAAAC GAAACGAAAT GAAATGAAAT GGTCGAGATG GCGCGTGGGT TAAACAAGTA TGATGGGCGT TCCTCATCGG AAATATCATT TTTCAACCCA TTTTATGCTT GTCCACGTTT CTTACTTCCA CCATGATTTT ATTTATTATA GAAAGTTAAT TTAAAACGGG ACAATATTTT TTCAATTTAA TAAAAAGGGA ATTTAAGGCA TATAAACAGT AGTAAACATA TTTAAAAAAA AAGCTAGCAC AGTAGTTTCT AGCACTCCAG TTTAAGGTAA TTGTGAAATA TAACTCAATC AACGGAAGTG AAATTCCATT AGCAAAAACC AACCATTCAA AACTCCAAGA ATTCTGGCAA CCACCGAAAA CCGCCAGGAC TAACAAAGCA TTTTTCCGGG ATGAAAGGCG GTCGCAAATG TGGATCAAGA GGCGGAGGAA AAGGTGGAAA ACGACGGAAA GCAGATTCAG GTGGATGGCC ATGGCAAAAG TCGAAACGAA TTTTTGCACA ATGCAAACAT AATGAGTTTG GGGAAATGCA AATAATTCGC AATGGAAATC ATTATTGAGC ACTGAACCAG ACGACAGCCG GAGCGCTTAG AAAATGGGCA AATAGGTGAG GTTGGGCTCC GATCCCCACT GGTCATCATG GTGGCGGGTC CACACAGGAC AGGAGGAGTT