Vienna Tile Information
VT ID VT041421
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200867
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 241421
Nearest Genes
Gene Nr FlyBase ID Distance
CG3199 FBgn0038210 618 bp
CG9652 FBgn0011582 49190 bp
Sequence Length 2163
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CAAGCTGTTCATCAAATGTGGCGATT
Right Primer TTCCCTGTTCTCCCAGCATAGTTTACC
Template genomic
Sequence CAAGCTGTTC ATCAAATGTG GCGATTATGC CAGGTAAGCT GGGATTACCT TACGTAGTGC TTAGTAATTA AGACCACTTA ATTTTTTCAG AGAGGGCGAA ACTTGCCCCA ATTTGGACAG GAACCTTAGC CCAAGGGACA TAGTATTTGT GGTCGGCAAA TCGCAGGCCA ATACCAGCTG CTGCGATCCC TGTCGAGATG CTCTGGAAAT CGAGGCGAGA AAACAGAAAG ACTACAGTAT TCAATCGAGT TCTAGTCGAA AATAGAGTAA TTTAAGGTTC ATAACTATCC ATCTATTACA AGATTCATTT AATACCACAC TTACACTTCA TCTCTTACGA AGAAGGTTTG CACAATTGAA ATCCTAAATG ACCTAGCTCA AATTTCCCTG GATCACAATG TTCAATGTTT TATTTTAGAT TCACGTCTCA ATTACCTTCA ATCAATCCGT GTTTGCTAGC AAAACAGCTT TAAAGTATCC TTTTGGGTTC AGAACTTGCC AAATGGAATT CGTTTCTTTT GGCTGTCAAA AATCTGCTTG ATTAGAAGTG ACTTCAATTT AGGATATTTT TCTGGCGTTT GTAGATAAGC AAATATTTGG GCACGGGATC AGGTTGGATT TTTATTACAC ATTTTGCTCA TTTTAATGTC CTGGCTGCCT TGAGTTGTTT GCCAGGACCT TCTCCTTCGT TCTGCAATTC GGGGCACACA TGTGTGTGCA TAAGGGAAAG TGAGTTCATC TATTTTTTAT TTGCCTTCAG CCAGATGCTT CAATATCATT CATATATATA TATATATATA TATATATATG TATATGTATA TGTATGTATA CGTTCATGTA AATGGCTGTA ACCCGCATTA TGCTCAAGGA AAATTTCAAT ATTGACTTCC TCGCGTGTTT TTGGTCCCTT TCCATTGTAA AGAAGTCTTA AGCCCAAAGA AACTCTCAGT CAAGTAAATA ATTGAATACT TATTCGATTT CTGAACTTCA TTTTGCTGCT TAGCATCGCT ATTCATCAAA AATCCATTGT TGGGAGACAC CTTTTTACTT TTTTTTTTTT TAAATTTCAT CAACTGTCTA ACATAATATT GCACATTACA CCTACATTGT GGAAAAGTAT CATCAGAAAG CCGCGAATCC GAGGAGAGCA ATTCTTGGCG TCGGACTTTC AGCTGGCAAC CTCAAACCGG AAATTAAAAC TTCACTCAAA AAAGGAGCAA GTGTGTGAGT CTTGGATGTT TTTTAGGTGG ACCTCTTTTA AAATGAAAAA CCATATGAAA TCTGTTCTGT TTATTTAAAA TGGCATTTAT CAAGTAAAAG CTTTCCGTTG GTTTTGCTTT AATTTGATAC TATTGTGAAT GATGAAATTC ATACCTTTAT AAAATATTAC TCATAATACG ACTAGTGTGT CGATAGAATT TTAATGATTT TAAAAGCATA TTTGTTTGCA CCAAATGTCC ACAAAAAGCT TACCATTCAA ATATCTGGTG TGGGTTAGTT ATTATTGTAT TATGTTATTT ATTAGACATA GAATCCCTCG CTACCGAAAT GTCCACCCTA ATTTCCTGTG AAGATATGAT TCCTCTATTC TATTTTCCAT TTAGTGCATT TCAGGCCAGC GAACAAAACA CCAGACAAAC ACTCGTTTGC GGTGCTCAGC ATTGAATTGA ATTCCTGCAA AATTTTTAAT GAACTCGAAA TTCCAGGCAC ATGCGAAGCC AGCAAGGCCA TTGCCGTTTT CTCACACTAC ACCACCCCAA ACCAGCCATT CACCCACTCA CAGCTTCAAA AAAGTGAAAC AATCGGCAGT GACGTGCCGA TATATATTTG TGGAAAAATA CTTTTCACAA AAAAGAAAAC AACTAACACT TACCTTTTCG AAACCACTGG CACTGCAATA ATTGAATCAA ATTCAACGTA ATACGTTTCT GTAGTCTGTC AATGATAAAA GCCTTTTTTG CTATCGAAAG CAATCTGGGC TCTGAATCCT GCTGAAAATA CAATTAAGTG AAAGCCAAAA ACACAAGCTT CTGCTTATCA ATATGCTTCA GTATTTATTT AAGTATTTCT CACTTTGCTT TAGTAGTTTT CTTTTTGAGT AAACTTAGTT GAGAGATTTT CAATTTATAC AGAATAGGTA AACTATGCTG GGAGAACAGG GAA