Vienna Tile Information
VT ID VT033051
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200860
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233051
Nearest Genes
Gene Nr FlyBase ID Distance
CG32204 FBgn0052204 1799 bp
Sequence Length 2095
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AAAGCAAGCCGCCCATCTCTGTTC
Right Primer GCCAACCAAAGTTTTCCCGCCC
Template genomic
Sequence AAAGCAAGCC GCCCATCTCT GTTCAACCAA AAGTATTTCC TCTCTCTGAA ATCCTTTTAA TCTTCTTACT GTTTGTTTGA ATCAGCTTAC TTATCAGCTT TTTTTTGGAC CCATCAATAT CGTCATTAGT TTGTACTTAT CTCGATTCAT TTTAATCGAA AACATATTGA TAAGCAACAC ACCATTGGTA TCATTTGATC AGTTAGTTAG TACGTCATTC AAACTGGTAG CGCATTTGGT GCAAAAGATG TGAGCAACAT GCTAATAGAT TTTTTTTAAG TGTGCGATTT TCTTTGGCCT TTTCTTTTAA CTTGGCCTTT GTTTTTCTGG TTTGTGGTTT CTTGCGTGGC GAAATTTGGC ACACTATCGA TGGAGTGGTG TATGATACGT ACACATTTCC TTTGGGGGGA CGGAGTTGCG TAGAAGATGC AAATGAATAC AAACAAAATA CCGCAAGCAG AAAAGATTAT GCCTGGCATA AAAATAAATT AATGGCCGTG GTGTGTGTGA TTGGAGTGTG TGTTGGTGAT TGTGTGGATG GCAAGGACAA AATTTCTGCC TTAGGGCTGT GGTAATATGG CACGACCCCC ACTTTCCACT TCCTCTTGGG GTAGCAATTC TTTTTTCTCT TTATAATTTA CTATGCGTAA TTTCCCCGAC TGCTTTCATA CGTAAATATT TAATTTCCTT AATTTTGGAG GACTCTATTC GGGGAACGCC AGACGGCCCT CTTTGCCTTG TTGGCTAGAC TTTTATTTCA TTATTTATTG TTTTTTGTGT TTCATCGCCA GGGCTTTTAT GTTTATTGCT GCTTGTGCCG AGCTATGTCA GTTTTGAGCT GGGCACACGC GGCGTATGCG CAACATTCTC AGCACTGCGT GAGTTTCGAA AATTTAAGTG CACAAAGTGC TGTCAAGAAT TAAGATCCTG ACACTTTCGG TCGTTATTTT GTTCGTGCTC TTTTTATGGT TTTTATAAGT TCAGAAGTGG TTAAAACGCA TTGTGTTTGG GCAAAAAGAA CAGTGAAACT ACTTTATTAA ATCACCTTAA GTGAGAAAAC ATTATGCTTC TTTACTCTGA GATCATAACG CGTTATATTG GATTTACTTC GTATATTGTT ATATTGAATG TGAAGTGCAT TTACTTTGCT TTTCGATTTT CTGCCGAGGA CACATTGATC CCTTTTCAGT GCATAAGGAC TCGGTGAGCC CTCCGAAAAA GATTTGCACT TTAGTGCAAG GAAGTGCAGA AGACAAAACT TTTGCACGCT ATTTTTATTA GTGCCCCAGA GAGAAAAAGT ACAGTTGAAA GTCTGCAAAG CATTTTTCTA GATTTCCATT CTGATGCAGT TTTCGCGCAC TTTTTTCTTA GCCTCAACAG AACTGAACTA AACTTAAACG CATTGGCATC CGTTTCTGGT CGAAAGCGGT TTATTGCTAA AGAAAAAAAC TTAAATAAAG TGGAATTACT TGTTTCAGGG GGTTGATGCC AAGGATTCTC AGGCGCTGAA AGTCGAGTCT ATTCCAAAGA AGTATTTTGC ATATTCATTC TGCGCTACTT TGTCGCTACT TGAAAATTGC GATTGACGGG CCAACTCTTG AGTTGATGGA AAAGTTTTCG GCCCAAGGAC CCCGTGCTTA AACCTCTTCT TTAACAGATT CAAGCTTTAG ACTTGTCTTC AATTAAATGT TCTTTAAAAC GAATTCATTG CGGAACTTGT AATATCTGGA GCATTACCCT GAATAATTCA ATAAATATTT TCATTTCCAA TTATGGCAAA TGGCGTAAGT TCACTGGGGA TTTTTTTGGT CATTAAAGTT TCCCCCGCCC GAATTAATTG CCCCTAAAAC TTACTGGCAA CACAAATATT ATTTTATGTA TTTTTTCGGA AGCCAGCGTT GATATTAAGA AAAGTTTGCC CAAGAGGCGT GGCGCATTTT CGTTGGTGTG GCCTGTTCCA CTAATGAGCC TATTGTTCGG CAGATAAAAC GTGGCTAACT TGGGGCCCAG AGGAACAGGA AATGGCTGTT GTTGTTCCCG AAGTTGTTGG CATTAGCGGA AGGGTTGAGC TTCGGGCGGG AAAACTTTGG TTGGC