Vienna Tile Information
VT ID VT039997
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200786
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 239997
Nearest Genes
Gene Nr FlyBase ID Distance
CG17230 FBgn0046225 2701 bp
CG31374 FBgn0051374 8483 bp
Sequence Length 2184
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CTTGCTGCGATCGTTGGTCTTCGTT
Right Primer GCCAAGTTATCCACCTCTTTTTCACTCAGG
Template genomic
Sequence CTTGCTGCGA TCGTTGGTCT TCGTTGGCTT CAACTTGATG CCGCCCTGGA TCTGCTTGAG CAGCTTGTTG TGCGAGTTGC CCTTCTCCGT CTCGTAGATG AACTTGTCGT CCAATTTGGT TATCGACTTG CACGTCAGGA TGGGCTGAGA TCTATTAGGA TTTGAATTGT TATAAAAGAG ATTTTTGAAC ATTTTCGTGC AGAGTTATCT ATTATTTGGC TGCTGGTACT TCTGCACACT TAAAATTTAA GTAAAAGTCA TTAACATTTG CCGGATAAAG TGGCGTAAAC GCAGTAAGAT GCTCTAGGTA CTCTTTCCTG TGGCCTTAAA TAACTTCAGT TTTCATTCCC TTTTTAATTA TCGGGAGTAT TGCAGTCGGT AATTACTGCA CAGCATGCGG ACACCACTCA CCTATCGTTG CAGGCCACAT GGCGCAGCTT CTTGCCGCTC TCCACCTCCT TCATCATCTC GGACCAGTCG GGGCGCCTTC GGGGTCGAGT CCTGCGAATC GAAGCGAATC GGAATTATGG CCATTCTGCG CCTTCAAGGT AAAAACTATC CCGATGCCAG GATATTCGGG TATGCAAGCA CTGGCGGTGG TCAGGGTTCA TGGGTCAGTC GTCGAGGTTT CCACTCACCT GAGCTTCTCG AGGGTCTCCT TCTGTGTGCT GCTGAGCACT CTCTTCTCAC CGGGAGCTAG GGGCGGGGGC GGCGGTGGCG GGGCCTTGGG CACCAGCGAG GGCAGCGGCG GCGGGGCGGG AACTGCAACA ATAAAACACG GAATGCACCC AAGTGGGCGG CGGTTATTCT CTGCCAAATG GTGGGTGGGG CACTCGCTGC AAGTGGTGCA AGTGGGCGCG AGGTTTGGTC GTTGGGCATT AGAGCAAATC GCCGGGCGCT GCGTGCACTC GCGGTTATTA AATATAATTT TAATTTAATG AGTTTGCAAT TTGTTTCAGT TGTTTGTTGT TCTTTCGGCT CCCGGGGGGT TCCTTAGTCA ACCCGCCAGA GGATTCGCCA CCCCAGTATT TAGCTGTGCT TTGCGAGCAA AGTTGCACCA TACATATCAA TACAGGGCAA AGAGAATGGA ATGGATGGCT TTACACTCCG AACATTAAGG GTTATTTATT CCTTTTCGGT TTTTGTTTTA AAAGGTTCTG ACTCTATCAA TTCCCCAATT GTATTAGTTT AAATCTATTT TCATCTTTTC AGCTAGTACA TTTTAAATCA CTTAAATGCC AATCTTAAGC ATATCTAACA TTTTCCTTAC AAAACAGAGG ACCCAAACTA TTATGTCAGC TGGATTATAC ATTTTAGAGA ATACATTTTG GGAATTGTCT AGTGTTTTGA AAAATGTCAG TTCATCATTT CGCCTTTTAG CCAAACACAA TATGAATAGA AAAGGCTTAT AGTCTGTTTA TCTGAAGTTT CGCCTGGTGT ATGGGGGGCT CCTAATAGAA TGAGAGCCTA GACACATGGC TGTCTCTGTC GGAAGTTGCA GCAGAGATTG AAAAGTTAGT GCCTGCCTCC GTTGCGGCCT CCGCCTACGT TTCGTCCTCG TCCTCGTCCT GCTCCCCCGA CACCGTCTTG TCGTGGAACG TGGACCTGGC TTTGATGGTG TTTTATTGCC TTAACACCAT TCATTCGATT TCTTTGGGAC TCATACACAG GCATGCATCA AGATGGGTTT CTTTCATAAT TTTTTATCGA ATACTTTGCA TTCCTTCATG CTTTTTCCTT TCGGCTTGTT GTTCAAAAGT GTAAAAGTCA AACAACAAAA AGAAGAGAAA AACAATGAAG GCACCACCAC CAGCACCATC ACCATCACCA TCACCAAGTG ATGAAAAGCT GACAAATCTG TTAATTAGCT TTGTTTGAGT GAGTCCTGGC AGGAAGCAGG GGCAGGAGAT TTGATGCCTT TTGGGTGGGA CTGTGTTACC AAGGCCACAA CCGCCAGGGC CTTATCCTTT GTCTGAGCTC CGGCTCCGGC TCCGGCTCCT TCTCCGTCTC CGGTTTAGTC TGCCTTCTCC TTTTTCGGTT TTCCAGTTTT TCGGTTTCTC GGTTGCGCCT GGCTGGATCT GCACTTAATC TTTAAGTGGT TGGCTGCCTT TTGCGGTGCA TTAGTATCCG AAATACCTTC CGAAACCCCC TCGACCTGAG TGAAAAAGAG GTGGATAACT TGGC