Vienna Tile Information
VT ID VT021420
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200740
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 221420
Nearest Genes
Gene Nr FlyBase ID Distance
CG5393 FBgn0015903 5137 bp
Sequence Length 2099
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTCTCTGTCGCTCCGCTGGGTTCTT
Right Primer GCCTTACTCGATGAACACCCCTTTTT
Template genomic
Sequence CTCTCTGTCG CTCCGCTGGG TTCTTGGTTT GCGCGTGTAT TTGCTGCCTT TATAAACATG TTTTCGCATT AATAATACAT TTTTATTCGC TAATTTAAAT GTTGTTTACA TTTAACAAAA AACCAGTTAG AGTCTGCGAC ATATCAGCAC ATATATAATC GCAAACACCA GCGGTCACAA CGATGTAGCT CGACTAAACT AAACCATACT TATATATATC TCATTAATAC TTTTGATTTT GCAATCTCAG CTAAATGATG ATGTTACTGT ATATATGAAA TCCCCAATGA TTCAATACCA CTAATATGTT GACCGCAAAC GTACATGAGT GTAGTACATA TAGAAACACA CATACAGCAG CACTTCTGGG TGGAGCCTAA ACTTTGATAA TTTACTTAGT CTGGGCATGT TTTTGTGTGT GTGTGCTTCT TTCTTATTCG TTATTTATGC ATTTGTTAAA CTTAGACTTG GGAATCATTC GATGGCGACT TAAGACTTAC TCTGTTTCCA AAACGCTCCC CATGGACCAG ATACCCATGC TTTTCACTTC ACAGCAGCTA GACCAACAAT TGTTGAATTT GCTGAGAGGA AAGGGTTGCT GGAAGTGGCT GTGTCGCTTT GTGGGCGATT AAACCACCCA CAATCAACGC CTTGAGCAGC GGGCCCATCC ACTTTGCCTC CCCTTTTGTT TGAAGATATC CTTGTCAACG CATTAAATAA ATGTTGTCGC ACCCCCAAAA CTGGCTGATC AAATCCTCAC CAGCTTTTTT CCAACTCAAA ATGTTAAACA ATGTGGTTAC CTTAATGTAT ATTAACATTT TTTTTTTGCA TCTGCTTGAA TTTGAGTGGT CTAAATAGAC ATGCAAGTCC TAGAATTTGT TTCGAAACTC AGTTCCGGAA CCCTTTGGTT CGTATCCTAT CTGCGTTGAA TTGAGTGGTT TTATCTCGAC AATTGGTAAA TGGCATATGA GTGTTCCATA ATTTCCATTA ATTGAGGCCT TCTAACTTGA TCAAGCACTA GACTCGGCTT CCATCCACTC CATTCAGAAA GGGTCGCACT TGGGTTTATG GCCGGACTGA GATAGGGGAT TTCGTTTGGA AACCGAAAAC GCCGTCCCAG ATTCAGATTC GGTTGACAAT GGAGCGGAAC TCGAAGCCGT GCGTCAATTT GGGGCAGCAT TGAGGATGGG TGATTGAAAC GCGACAATTT GTTTGGTTCT CAAGTGCAAA TGCTCGAGGA GCGAGCACAA CTTGAATAAC AAGCAATGAG CAATCCGGCC ATCGGCAATC GTCAATCGAA GGGGGAACGT ATCGCACACA TTACACCAAT CAATCCGAAT CGGATCCAGC TGCCCCTGCC TCGAATTCAA GTAAACAAAA GCCATTAGCA AATGTGTATC CGAAAGATGC ACAAACGGCG ACACTTGAGC TGGTGTAATC AAATCATAAA TTCATATATA TATATACACA AATGGAGATA GATACGGGAA TATGCTCGCC CTGTGTCATT CTATGCATTT CCATTAGAGT CGCACAAATA TACATAGAGT AGATGGATAT ATGTAGATAT AGTTATAGAT ATACATATCC CTTCCAGTCC GACGACGCTT TCGTAATTGG TTCAAGTGTC TTTGGTCTTT GGGCTGCAAC CACAGAATCA CAGCAATGAA ACACAGAAAC TGTACTTTAT CGCCAACAAC AATGAGTTGT CGAATCCCAA AAAACCAGCT GGTTGTTACG AACGGAAACT CCTTACCCAT CCTTTCCCTT TCCTCACCAA CCTCCAGCTC ATCTCCGCTC ATCTCCTTCT TGCGCTCCAG GACTTATCAA ACTATCTTCG AGCGTTTTGC TGCAACCCCT TCGCATCTTC CTGTCGTCCC TGCTGCCATC TCACCTAGCT GAGTTCAGCT CCGCCTGTCC GTCGAGACTT TTCTTATTGT CTATACCCTA ACCATTAGTT TCCAACTGGG AGTAGCAGTT GATGATGTCC TTAGGACTGG TATCTGCCAC TATCTTACGA TTTCTAATGT GCAAAATGAA ATGCTTCATG TCTTTTGGTT AACAACTTTT CAAAAAAAGG GGTGTTCATC GAGTAAGGC