Vienna Tile Information
VT ID VT043789
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200714
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 243789
Nearest Genes
Gene Nr FlyBase ID Distance
CG12345 FBgn0000303 3185 bp
CG32848 FBgn0015323 3256 bp
Sequence Length 2145
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTCCATTTCGGGGCAGCTGGAAAC
Right Primer CAACAAGGTCCCCACTAAACAGACCA
Template genomic
Sequence TTCCATTTCG GGGCAGCTGG AAACTGGAGT ACGGATCCTC GGGCTAAGTG GCTGCGTGTC CACTGGGAGT TGATAAAAGC ACATCAGCGC GGCAACAATA AGAGCAATAA AAACAAGGAC CTGCAGCACA GAGGGTTGCT TACAAAGGCA CAAAGGGATA GATACCCTGT TTAAATTGAC ATTTTCCATC GTCCCAAAAA CTTTGGCAAT TAAAAAAGTG CTTTACAACG ACTAGCCGAG CTAAGGCCAA CCGGGTAAAA TCGATTGTAC ACGAATCGCA AGACCGCGAC AAGACAATTA AACTTGAAAC AGAAATGTCA CTTGGCAGTC GAGTAAACAC TTGGCAGTCG GAAGAGGGTT AAGGTAACGC TAGCAACGCT GGCCAAGTTA ATCGATCAAG AGTGGCCAAG GTGAGGCTCA TTAGCTGGTC ACAGTTCATT AGAGCCAATT GCTCGGGAAC GTGTCTTAGC CACATACTAA CTACTACTAC TACAACTACT ACTGCACTGC TGCCCACCCC CTAACAGAAC TTCAACCCTT CGGGCCACTT GAACAAAGCA GCTTACACCA CTTGCGGAAA GTTTTACAAG ACCAGTCCAT TTGAAAGGGG GATGGTATCT CGAATCCAAA TCCATATTGC GGACCTAACA CTTGTGAGGA TTTTCCGCCG GCTTTTGTCG AGTGCGGCTT ACCATAAATA TTATGATATA TTTTATTTTA TTTGCTGCCC CACCTTTAAA ATTGACACTG AAACGAAAAA CGAAATATAT TCTAGATTAT TAATTTTAAT GGCATTCGCT GCGTTGCCTG GGCAATGGCA AAGCGCCAAA GCTCACAGTT ACATGCCATC ATCTCATTGC AAATTCAAGT CGAACGAAGC CCACGATATT GTGTGTGTGT GTGTGTGTGT TTTTTTTATG TCTTACCCTT CAGGGGAGCG AGGGCAGAAT GAAATTGTAT TTTACGCTGA TTACCTCGTC AGACAGACGC TGGCACACCC AGGACTAAAA AAGCGAATGT AATTTCATTC CCCTTTCTCG CAAAGTAAAT ATCCTTTGCT GTTGCTCAAA AAACGACAGG ACGACAGACG GACAGGAGCA GGCTGCGGAT GTTCCCAGGG TTACGGGTCG GGTGGCAAAA GTCGGCGATC ATCCTGCCAT TGAAAAGGCT AGTGAGTGTA TAAGTGGGTG GAGCTTTAAG CCTGGCTGAG AAGAAAACAC TTCCTTCAAT TGCTGCCCCA GAATCCCATT TCGTCCTTTG TTGTCTGGCA GAAGATTAAA TTTTGGCTTT GCCTAGATGG ATTGGAGCTG GAAAATTTAA AGCCTCCTGA ATATTTAAGG CAGCACCTGA AGCCCCTGCA CAGCTAGCGT ATTATTAATG AGACACAAAG TAGAAACTAC ACTATGCTTC CTTCTCCGGA GCCTGGGAAA ACACATGGGC CGTCATAATT TACTGCGGTG GAAGCTGCAT AAAATATGAA CTCTTCGCCT GCTAATTGAG CCAGTCGGAA GTTGCCATTC GACCCCAAAA AGAGATGAAA AGGAAACCCA GCAGGAGTTG CAACAAAAGG TCAGGCGAAA CGACTAACTA AAACGCAAAG CAAATTCACG ACCACAAGCC AATAGAATTT TCCATAAATG TTCAAGCATT GCCTGGGAAA TCCATCAGCT GTCCAGGGAG CTTTGCCAGA CAGGGCGGAA AAATCAATAA AATTATAAAA GCGTAAATAC AAATTGCTGG CTCATTTATA AACAGACATA CGAGTATATA CATATATACG CAGCATTAGT AGGTGTGTTC CTTTCAAATT GGTAATCAGT CAAGTAAATA TAATAAAATT TCTTTGAAAA CATTCTGAAA TATTTATAGG AATGAAAGAA GCAAAGTTTT TGATGTCTTG TCGTGGGCAC GAGTTCTGTG AACAGCTTAT ATTATTGTTT ATCATACCAT ATACGGATTA TTGGCTAGGA ACATTATTTT AATATTTCTA TAAGACCTTC ATTGAATTGT GGAATATTAT ATGTATCTTA AAGACATATA TTAAAGTATC AGCTGGTTCA AGGTTCTTTT TCGAATGTTT TGTTATAATA TTCCTTAAAA ATACGTGAGA TACATTGAAT GGTCTGTTTA GTGGGGACCT TGTTG