Vienna Tile Information
VT ID VT000926
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200692
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200926
Nearest Genes
Gene Nr FlyBase ID Distance
CG31665 FBgn0051665 11407 bp
Sequence Length 2186
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TTCACCCGCCCAAATCTGTTCTTCT
Right Primer TTTGCTACCCACTCGCTTTTCCTTG
Template genomic
Sequence TTCACCCGCC CAAATCTGTT CTTCTCCAGA CCACGGAACA CTGCAAACCG GACGAGCACT GCGTCCCGAA TGTCCTGACT TGGCGAGGTG AGGCAGAGAT CCAGTCCGGC GACATTTTAA TTGTGGAAAT CAATGATGCC ATGCTGAATC CTTCGCACGA GCCGAACAAC ACGAGCAGGT GAGTGGTAAA TGGATAGTTT TAACTGCTTG CTAAAAAAAA AAAATGGTCC ATTTAAATTG TTGTGAGCGG GACATCACTT TTTAGTGCTT CGGGTTAAAT TAATTCCGCA AACAAAGGGA AACAGTCTAT AATAGAATTG TATCGCAGCT GTGCACTCGA AACTTTCATT TAATCCTGTT GCCAGTTGTA AAAGCGGAAA AAATAAAACT TTTGCCACAT TGCCATGATT GATCATCGAT TTTTTCTCTA GGGGCTGAGA TACAGAGATG TAATGCAAAA TGTAAATTAT AATTTACTAT CGAAAACATT TTAAGGGTAC CGCCTGTTTG GTTGCCCTGT AGTCTGTAGA CGCATAGATG GATTTTCCTA AATAATCTGA GACAATCACG ACTTCTTTTG CGTCATTTGA TGTTGTACAC AGACCAACAG TATCAATTTA CGGGAGATAA GGGATCCAAT TACATAATCC CCACTTTTGG CCGTCGTTAC TTGTTGAAAG CGTTGCTAGC AAAGCGAAGT TAACCTGACT ACTGACTACT GGCAGTGATG TATGTAGTTG ATCAAAGCCG GTGACTTGGG TCCCGGGAAA AACTGTCATT ATGTGCCATC AGCAACATCA TCAACAACAG CAGCAACATC AGCAACTGCT GCCTCATCAT GGAGCTCATC ATGAAGCGAC CCTTTCGCCA GACACCTGAA TTCACTGGAA AGGGAGGGGG TGGGGGCGTC CCCTAAGTCC ATGGCACATG AAATCACTCC CTTATTTTAC ACCTAGTTGG CATGTTGTGG GTGTGCGTGG GGGGGCTATT TTTAGTCTTG TTTTTATTTT CAGTTAAACG CTTTAATGCG CACTGAAACG TGTTTGTTTG AGGGGCTTAT TATATAATAT CGTCCATTAA GGACCTTTAT TGATTTTTCT CCAGCACGTC TGCTCGAGTC GAAAGATAGG GAATAGTTAC AGGTCCCAGA CACGTTCGCC ATTATCTTGG CCTTTTTACA GTTTATTAAA TTGTTTACTC TTACTCGACA GTCGCTGTCT AACTCTCCTT TCTGGCCATA TCCTTTATTT CTGCTCACAA ATTTTTATTT CCCCTCGCTT ATTTTATAAA GCCTGACAAA AGTGCCCAAA CAAACTGCGC ATATAAATGC GAAATCAGCC AAGAACAGTA AACAATGTGC TGTGTATTTA AATATATTGT AAAAAGTGGA TGGGATTATT AACTAAGCTT ATAAGAATGG CGTGGAATTA AAATACGGGT TTAAAATCCC TTAGCAGCTT TTGTAAATTT CTTTTATTTT ATTTTTTACC CAATCAATGC CCGTTTGTTT GCGATTTTTT CTCTGCGTGC AGTCCAAGTT GTTGACCATT AGTCATGGAC CTGAACATAC ACACACTCCA CAGCTGGCTG ACCCTTTTTG CCATGGCAAT TATCACGTTT CTCTCGGCTT TGCTATCATT TTCGGCCCGG TTGCTGGCCA CACTTTTTGC CCTTTTTAAT TTAGCTCGGC TCGGCTGGTT CTTATCTTAT CACTTGATAG ATGCCGCAGC CGCCAGCCAT CACAAAGTTT TTCACCCCGA AGAGAAGCGC AAGAAAAATT AAAATTCATT TGTCGAACTT TGGGCCAGAC ATCAAACGCG ACCGCGCTGG AAATTTTCCG CTTTTCCCTA TATTTCCGCT TTTCTTTTTC CCTATCCGGC CCGCGGCAAC TCTGGCAACT CGAAATGCCT GGCATAAGTT CCGATTTTGT AACTTTCCTG GGGCAAAATA AGACCGCAAA CAATCGAGTT AGTTGAGGAG TGAAAGTGAT GCGAGGTATA GCGCACAATT GAGCGCAGGG GCCGCAGAGA AAAGTTCCCG CCAACTATGA AAATGAGATG TCAAAAAAGT TTTTATTATC GATTTAATAT GTGTATGTGT GCGTCGACTC CCGCCAAGTT AACAAATGCA ATAGCAACAA ATAATAATGC TGCTGCGAGC CCAAGGAAAA GCGAGTGGGT AGCAAA