Vienna Tile Information
VT ID VT058715
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200636
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 258715
Nearest Genes
Gene Nr FlyBase ID Distance
CG2302 FBgn0015519 11459 bp
CG1387 FBgn0030033 42493 bp
Sequence Length 2154
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ATTACGCATTCCGCCCTCACAACTC
Right Primer CCTTCGCCCCTCCCCTCTTTTC
Template genomic
Sequence ATTACGCATT CCGCCCTCAC AACTCGCTGA TGGTCAATAA TTGATATTAT TCGAATCAAT TTACAAGCGC CCTTTTGTCA GCGAGAATGT TTCAATTATT GCGATTTTGT GTTTTCATTT TTTTTAATTT TTTTTTTCTG TTTTGCAATT GGTTTTGTAG TTTTTTGTCT CGCTTTTACT ATTCAGTAGT ATTGCAACAA TGTTTTTTGG TATGCGGTTT TGTGAGCGCG GCTTCTGCGG TAAACGCGAA TCCAACAGAT TTGCAGCGCT TAATGGAAAT TTTCAATTCA CTTTGACACT TTATGACAAA CTTTGGTTTT GGCCACGGCA CAATGGCAAT GGCCACCACA TTAAGAGCAC AACAAAAACC ATCGATGTGA GCTTTATAGC GGCTTTAATG CCACGCCTGT CAGACGCACT TGTCGCCCCC TTTCTCCGCT TTCTCCGCTC TCTCTCTCTG CTTTCTCGGT CTTCTTCCCA TATCCCAATT TCCCCATTTT CCCGTTACCC CCATTCCCTT GTTGCCTTTC TCCTTTTTCC ACTCACCCAT CCAGAATCCT TGCTGAGCCT TCGACGCCAA TTTCCAAAAA TGCTGTCAGC AATTTTTGGC TTCGACTATT TTTTGTTTGG TTTTTTTCTT TACTTTTTTT TTTTTTTGCT GCTGCCTTTT GCTTTTGTTT TGTTCGGCCG TCGTCAGCTG CCAGTAGCAC TTAAAGCCAA CAGGAGCCAC AACAACAGGA CGAAGAGGAC ATAGCGAAAC ACAGGCCCTT TCGCATACCT TATATGAATG TACATACATA TATCCTTAAA TGGTACATAA GAATTTATGT GTTCAACGAA CGTTTTCTTT TTACTTCTTT TAAAAATTAC TCAAGCTTTT GTAATTTGTA CATTTTGTTA GATTTCTTGG AATTTTACTT TTAAAACAAT CATGCCACCT AACATCATAT TCAAGTGTAC AAATATACTC TTTCACTTAA TGAAAGGTAC GAAACGCCAG CTTCAGTGAC TGGCAAAGGT GTGCAGAAAC TACATTTTTC CTCCTCCCCC AAAACTTTCA CCGTTCTGGC GAAAATCCAA GCCCAAACCC GAGGGCCGAT AATTTTGCGA ATAAAGTCAC GTTTTGCTTA TTTAACATTT CGTTGACTTG CCGAAAAAGA AAAAAAAATG GCTCAAGAAA TGTCCTTAAA GCCATATGGC TGCCATTTGC CATCGCTTTG CATTTATTCA TTTAGTTTGT CGGCCCTAGA TACGCGTAGG CCAGAAAGCA GTTGGCAATT TTCGGCGATT CATTATGCAT TCATTTCGGC TTTGTTCGAT TCACTAAGCC CCAACATAAA CAGCATCGCT CGTCGCTGGG CAATAACGAT AACTTATCGA TTATTCGCAT TAATGGCTTT GATACGCCCC GAGAAACGGA CGGAGTCCTG TCAAAAATAA CAATAGTCAT TATAATGAGT TTTGAGCTCC TGGGCAAACG TATTCTTGGA TCGTGATTTC ACTTAAATTA CGCAATAGCA ACTGCTGTCA CTCTAAAGTG CTTTAATTTA TATAATCAAG CTTAATTCCA TTGGCACTTC CATATACTTT CATATATATT ATCTAAATCA TTTGAGTTAT ATGGAGCTTG TTTATAGCAA TCAGTAAAGA TTCCTTGAAT TAAGTGCACA GTCTTTAGTA TACGAATTAT ATAATTATCC CAAACTCACT TACAATGAAG TTACTATCAA TTTTTAGGCC AAAACTATCG GCGATTATGC AAGTAGCTTA CCTCTTGCTT TTTTTGCTCG AACTTAATTT GCCGCCTCGA GTGCTGCGAT AGCTATCGAA ATTGTTATGC CCAAGCCTCA AGTTACCCAT TATCCTGTGG GTAGGATTCA CACTCACACA CACACACACC CAAGCGCACA TACGCACACT AGCATACAAA CGCACACAGA CACACACACA CAAGAGGAGA AACGCAGTTG CGGGTGGGAA ATTGCCAATG GCACAATTTT CTTTTGTGTT TTTGTAAATT GTGTGAATTT TAACACTTGA TATTCTTTTA ATGAATTATT TCGCCCAGCT CGTTCCTTTG GTTATTTACA TTTTTCAACT CTTTTGCATG CCAAGACCGA GGAAAATTGT ACGAAAAGAG GGGAGGGGCG AAGG