Vienna Tile Information
VT ID VT043144
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200630
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 243144
Nearest Genes
Gene Nr FlyBase ID Distance
Sequence Length 1378
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGATATGGTGTATCCTTGCAGCGGAG
Right Primer GTCCTGGCCTACACAGCTACTGGCG
Template genomic
Sequence CGATATGGTG TATCCTTGCA GCGGAGCTCC CCCATCGTCG GGGGCATCCC AGCTTACGCG AATGCTGTCG GCGGAAGCGT ACTGCACGAT GATTTGCGGT GCGCTCGGTG GCTTCATGGC AATCACCTGG TACTGGATCT CATCACTGCC GAACAGATTG TTCGCCGTGC ATGTATAATT TCCGGAGAGG CTGCCTTCGA CGCCTGCAAA GGTTAACGAG GAAATGGAAA AATGAGTGGC AAATTTACAA AAGGTAAAAC CTGTTATTAG CTTATAGTAA AACTAATTTA ATCAGCTCTT AATAAACTTT GTTTTGACAC CACCCTGCCA AATATGAAAT ATTAAATTAT ATTGAAGATA GCACGATTTG CTAATTCGAT ATCTGATACT TGTTTCGAAA GATATTTATT ATAATTTGCT GTATCACTTA CGGTGAATCT TCAGGTTGCC CTCGTTGGTC ACCTCGTAAA AAGGACTGAA GGTGACGGGA CGATCGCGGG TTAGCCATCG AGCCCGTGGT GTGGGATTAC CCACCGCCAG GCACTCCAAC ACCAGTCCAG TGCCCACCGC CTTGCGCACC ACCTGACCAA AGGAGGCGAT TCGGGCGGGA GCTGAAACGG GGGAAATGCC GAGGAAAACA CAAAATGAAC AACAGAAAGG CAGGACATTT AGTTAGGTGA GCGAAATTAA AATGTTGCGG CCGGTGCGGC TTTTCGCTCG CACGCTGAAT AAATGTCAAT TTTTAATTAA AGCGACATTT ACCGGCTCAT TTATATACGT ACACACGGAA AAAGTACTCA GTTCTTTTGT AAAAACATTT TTTATGCACT TTTTCAAATT TTCCATTAAA ATCGAACTGT GGTCTCGTTC TCCGAGTGCA TGCGTGCAAA TATTTGTATG TATATTGTAT TTATCTGGAT GCAACCTACC TCGCGTATTG GTGGCCTGGG CGATCACAGA TGTGGGCTCC CCTTCGCCCA CGGATGTCGA AGCCGAAACC CAGAATTCGT ACATTTGATT TTCGGCCAGG CTGCGTGACT CGAATGTCAC CGGATAGCCG TTCTCGTCGA CACGCACCAT GTGAGCTGGA CCGGGCGAAA AAATTAAATG TCCGTATGCA TTTCAGCGCC GCGCGTTGGG CGCCATTTCT TTGAAACTTA CTCTTAGCCT GGCCTTTGCG ACCCGCCTCC CTGGAATAAA CCGTGTAGTG CGAAATGATC CCATTGCGAT TTTTCGGCGT TAGCCAGGAA ATCAAAATCG AATCTGCCGT CAGGGCTGCT GCCTTAATGG CCGCCGGTGC ATCGGGCACG TCGTCATCCG TCTGGCAGAA AAGCGGATGA CTAGCCAGGC CATCGCCAGT AGCTGTGTAG GCCAGGAC