Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT033043
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200622
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233043
Nearest Genes
Gene Nr FlyBase ID Distance
CG32204 FBgn0052204 16014 bp
Sequence Length 2186
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCATAGAGGAAGCCGCCAACTTTTT
Right Primer AGGCAATAATGGTCCACCCCAATCC
Template genomic
Sequence GCATAGAGGA AGCCGCCAAC TTTTTACATA TGTAACGGAT TCGGTTTGAT TTGTTGTCCT CGACGGCTTT TTGTAATTTA TTTGCTTGCC TTAGCTGACT TGAAGCCCAT TGATTTATGC CGTGCGCCGA GCGGCGGCGC AATTGATAGT CTGCTTATGC AACAAGGACC TCCCGATGGG CCCGAATCCT TTGTGTGAGA TGTTTTCCAT TAAACAAATG GTCTCCCCAG CACTGCGCTA TGAAAACGTC TTCGATATGC ATTAAAAACA TTTCACCCTG GCTATCCGGG GATACGATGG AGGAGCACTC ACCTTATTTA CATGGTCGCG CAGGACATTG GAGTAGACCA TGGCGACAGC TTCCAGGGCC ATAAATGTTA TATAGCCAAT TATCCAGGGT ACAATTAGTC CTGGGTTCTC CTGTGGAAGG ACGAAAAAAG CGGAAAGCAC CTTAAATATA TTGCCATTAG AAAATAAAGC TAAAAGGGCC ACCGAAACCA GTACCTGTAT GGAATTGGAG GTATTGATTT CATGGCCGTA CTCTAAAATT TGCCAGGATG TGGGTGTTAA AAAAGCGTGA GTGCGGTGCA ATTTATCTCG CCACGGTGGC GAAACCCCTG ATTGGATTTT TTGGGGTTTT TTCAATGTGC TAAAATTTTT ACTGAGCACG TTGGGAATTT CTGATGTGCA GCTGACAGTT TTTGGCCGCA GCGGTTTGCA TGGTAATTTT GTGGGGGCAT GAAAATGTAT TTTACCAGCG GATTACATTT TAATATGGGC TATAATGCTT GCCTAATTTT TGAAAATGCA ATTAATCCCA TAACGAACAT TCTATTTAAG CAACTGTAGT AAAGGGAATT TGTGAAATGA GTATAACTAT GGTTACAAGC TAGTTTTATT TAATTATTAC TTTAGTTGAT TGAGCTGCTC ATTTAGTACT TATTTTGTAT AATTTAATAT TCGTTTGAAA ATACATGTTC GTTTTGAGAT ATTAAAGTAT AATTTTAAAT AAATGTTAAT GTTTTAATAC TCATTACATA ATGTATAGTT GATTGCACTG AATTTGCATT TAATGTTTAA ATAATAAAAG AGATAATTGA TTCCGTTTTT CAACTTAAAA TTAAACAAAA TCCAGTGTTT TAAACAATAT TTCCTAGGCA TTAAGTTTCC TTCATTTTCA GTTTCACCGT ATTATCCAAT TTATTTGCAG AGTTCGAATG CTGAAATTAA TGCGTGTGTT TTGAAGTCAA GCCGCAAGAG TCCTTAGAGT CCAATAATGA ATTGTTTGGC TATTATATTG GCTATCAACC GCAATGTTGT CCAAAACTTT TGCTCTTTCC CCCAACATTT GTTGTCCGAA CGCTCGTTTA GCCTAATTAA GAACCAATGC TCTATGCATT ATTTAATGGC CATCTGCTGC GGGCTTTTGG CCTAAGTGTC TAAGAATAGG GCGCCAATTA GCGAGCTGCA ATTAATTTAA CCATTTAGCG GACTTGGTTA CATTTTCATT AGCACTGGGC AGCGCCAACG ATGGCATTCA TTTTCGTCGA ATTCACGTTC CAATTTTGTC TGTCAGCGTC AAAATGAAAA AATTCCACAA AATGTACCCG AACTGAACTC GGTCTATGCA ATCCTTCTCA AGGGTCCTGG CAGCTCGTTT CGCGACGAGT CAGTCAGACT TAATCCCATT CCTGTGCCAA TTGTGTGACA AATTGTCCAC ATTTTCATGC CGCTGTCGAT GGAATGCTGG CTTTTTCACA TTTAGGGGAG TTCCTTTTCA TACCACAAAT TTTACAAAAA AAGTTCAACA TTTTACTATG GCAATATATT AGTAAGTGTA AAGCTATACA TTCCAGAAAA ATTGTGTTCT TTATTTAATT TGAACTCGAT TACATTTTAT GACTAACACG ATTACAAGAT TAATGTCTGT TTTTAATTGT AGCACTAAAA CCTAATTTTT TGAGTGTACC CCATGCACAG CATTTGGCGC CCAACAAAAT CATATTAGAA TTTTGGAAGC AACGCGGTAT GACCGCTTTC AGTAATTTAC ATTTGAATGC GCTTTGTTTG CTGGGTAAAT ACTTTCTGAC TCAAAGGCTC TGGGAGGCAC AATGCGCCAA ATTTGCGGAT ATTTGATTTT GAGTATTTCG ATCTATGGGC GGGATTGGGG TGGACCATTA TTGCCT