Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT001971
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200611
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 201971
Nearest Genes
Gene Nr FlyBase ID Distance
CG16738 FBgn0003430 2735 bp
CG2939 FBgn0004567 6148 bp
Sequence Length 2282
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTCCCCCATACATACATATCGCCCC
Right Primer ATTCGGGTCAACAGAGAGGCCAAGA
Template genomic
Sequence CTCCCCCATA CATACATATC GCCCCTTTTT ATCTCCGGCG AGAAGCGATC GGTAGCAATT ATCATATTTT GTGTGCCCAT TTTTCTTCGA TTCAATAATT GTAAATTATT GTGTGTGTGT GTGTTGGTAA ATCATGTTAT TGAAGCGATT AGCTGGCAGT TTTATAAGGT GTCAGTTAGA AATTGGGGAT GCTTAAGCGG CGGAAAAGGT TTTGGGGATC GGTTGGTTGG GTTGGTAGTT GTGCAATAAA TCAGTTAACA GGTTGGGGTT ACCTCATCTT TTTGTAATGA AATGCTTAGC TATGATTATT CATATGTTTT ATAATAGTTG GAAATTGAGA TTGTTTTGTT ATTGTAGGCT TCATTGTTCA GAAAATCTCA GTACACATAT TTCTGCTCAT TTTAGCAGCT CCCAAAGAAG CACTTTTCTT ATAGAAAACA TTCTCCCATT CCATAGCTTG TATATATATA TTTGGGGTTT ATGCTCGGCT TAGACCAGTG CAAGAGTTAA ATCGGTTTTG GCCCACGCCT TAAGCCATCG ATTCAAATAT TTTGCATATC CATATATACT TATGTCCATA TACATATCTG TTTTGCTCAA TCCGCAGATC AGGCGAATAG AACAATTTGC TGGCCGCATT GTTTTATTGC GCTGCCCGGC TTAAGTTGGC CTGGTTTGTT ATTGAAATAG ATCGGATGAG CGCATTATAT ACTTAACACA TCTCATGTGC CCTGGATTCG GATTGAATTT AGAAATCCAC TTACCTAAGC CCGGGACTAG CTCTAAGCTC TAAGTCGCTA AATCAGTCCG AGGGTCTCGG GATTTCTTAA ACTACATATC ACTTTAGAAT AGAATTGGTT GGGTATACCG AATAACCGAA TGGTAATAGT GAATAGTGAA TAGCGAGTAG CACGCGCTCG ACCAAAAGGG AAATGGATGT GAAATTGAAA ATTTCTTAGC CAAGTCTGCT TTCTATTGGC TTAAGTGCTC GACATGCAAT TTACAAAGAT AACAAGCAGA AGCAAAGCGA AACCTCGGAT CTGCCTTACT TATCTTATTA CCCGGGTTAA GTGCAGGGAT TACGATGTCG AAAGAGCAAC CTTGTGGGTC CTTGCGGGTC CTTGTGGTCC TCTGAATATA TAGTATACAG TGTGCAGAAG GGCTCAACCA GCAGATGCCG AGCACTGATT ACCCAGCATG CGTGCTCGCA TCCTTCGGAT CCTGGCATAT AGATCATACA TAGTAGCCAG GATGCGTGTG CCGTTTGTTA CACTTTTTGT CCATTTAGAC TGCTCCTGGG TGCTCCTTCC CAGCTCTAAT GATTCAAACC CATCGGCTTA ATTCCTGGCC GGGTCTATTT CATAAATATT TTATATATAA TCGGCTAGTT TCTCAGCCGC TTTGTTTGTG CAAAGGCTTA AGATCACCAG TGGTTTTTTC GATCGGTTTT AGGGCTACAA GGATTGTATA CTTTTGAAGT TCAATAGAGC AGTTACTATG GATAGGAGTT GTCTTGAAAA TATTTCTTTG TAAGGTGTCT AACTGATTGC AAAGGTGTGG AAAATGGTTT CAGGATCAGG TATCTGATAT TTTGTGTAAT ATTACTATAG TTGTTATATA TGTATGGTAA AGTATACAAA TTGTTCACCC AAATTGCGTA ATTGGATCAG TTGAAACTAT CGATGAGAAC CTCAACATCT GCTAACCCAC TTTGTTGACA GTTAGCAGTT TGGACCAGCA GCCAAGTTGC CAAGCAAAAA TATTGACATT ATCGATTGGT TTTAAAATCC ACCACATGGG TGCACCACTA GTCTTGTATA CTAATGCCCA CATCAGCAGA AACGGAATCA AAGAAACACA TACAGAAGCC CCTCAAGAAT TGGGTGTGTC ATCTAGGAGT AATGCAAACT GAACTATGTA GAAACCGAGC TTAAGTCGAG CCCAACCCAT GGAGAACCAA ACCAAGTGGC GACCACACAG TGACCACAAA ATGTGTTTTT AATTGAAACT GATGTGGCTC TGGCCAGTAG GCAGTATAAA AGTCTGATGG GTTCAGATGA GGGCAGGGCA TTCAAATATT TATTAATACA ATAATTGTTA ACCCATGGGT CGCGAGTGCT CGCTCAATAA TCAAATAATG GCAATACAAA TACAGCGAAT GGGAAAATAT TTGAAAATAT TTGAGCGACA AATGCGCAAA GTAACGAACA CACATGTGGG CAGTTTGGTG GTGCTCCTTA ATTAGTTTCT TTCATTATCT TGGCCTCTCT GTTGACCCGA AT