Vienna Tile Information
VT ID VT055852
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200573
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 255852
Nearest Genes
Gene Nr FlyBase ID Distance
CG13758 FBgn0040378 4665 bp
Sequence Length 2167
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AGCTACAGTTTGAGAGCCATTGCACA
Right Primer TGCACATATAAAACGAAACGAAAACAGACTCA
Template genomic
Sequence AGCTACAGTT TGAGAGCCAT TGCACAAAAG CTTTTAGCCA AGTCAACAAA AAAGCTTTCC TAAAGCGTTT GCCACCAAAA GTATAAGTTT TTAACTGAAT AAAATTCAAT TATTAAAGAA CAAGCTGTTT CAATTTAATC ACACATTAAG AGTTTATGAA ATAGGTGACT TACAGGATCT CATCTACTTG TCAAATTGGT TGTCAAATGT GGCCACACGG ACAATCCAGA AAATGACATT TTTTTGAAGT GCTTAATAAT AGATTTAAGG GTTATTTTCC ATTTGTCCAT ATATCCTTTT GACAACAATG AAGATATCCC TGTCCCATTT ACATTCCGCC CTCGTTTTTT GCACTCACTT TTACATTTTC CGAGCACATT TTTGGTTTCC GTTACCGACT TTCGACTTTC ACACTAAATA CTCGCCTTTC CCATTTTCTG GCCCAGTCAC GTGTTTCGCA ATGGCAACTT GTTTACTTTT GCATACGTAA AGGCCTGGGT AAAATGTGCT AGTGAATTAG ACGAGGACGA TATTTTGTAA TTGAAAACTA ATTGTTGCCA TGAATGATTT CAAGCCACAG AGCTGCTTTC TATTTTTGCA TCCGGTAAAA ATAGCCTTTA CGCCTGTTTA ATTATTTTCT ACAATTGAAC AGGAAATACA CAGCGAAACA GCTTATTGGG GTAAAGTTTG CAAAAAATAT AACTCATACG CCCAGTGTAA CAGGTCAAGT TGTGTTCAAC ATGGCGTATG AGCGATATTC CAAGGTTTCC ATTGTTCAAA AGAAGAACGC TGCCATTCAG GAAAATCTAA CATCTAGTGA CTCGTAAATG ATTGCTAGCA GAATTACGTA TGTGTAAAAA CTATGAAACC ATAAGTGTGT ATAGTTTATT TTATTTTACT TATTTATTTA TTTTTTTTTT TTTTGTGTTT CTTGCGCACC TGCAGCTGAC ATTCCAGCCC AAGTTCTAGG ACAGTGCGAA GCTATCTTTG CCAATCAACA AGCTTCCCAA CTCGCAAAAT CGACTGCCGT ACACATAGAT ATATGTACAA TGTACGTTTA AATCGAATTT CAAGGAAAGT CGGTTACGCG AAAACCCAAC GAACAGTTCT GTTCCCCCGT AAAGCCCAAC AAGTGGCAGG TAACAAGTTG AAAACTGCAG TTTGCATAAG ATGGATGGAA CCAACCTTCG GTGTTAGTGG TGTGGGAAAG GAGCTGGTTA GCATCTGGGA GGCAGCATCC CATGTCCATA ATTTCAAACC GATTGTTGTG CAATTGCCGG GCAGTCTGCG TGTGGATGGT GTGTGTGTGT GTGTGTGTCC TGCTGCGGAA AAGGTCTCAC CGGGCTCGTC TGTTGAGTTA CCAAGGCAGT TGCTAATTGT TTGGCCGGCT TTCACTCAGT TTTTGGCAAG CCCTTTTTGG TCGAAGCTTT TAGCTTAATT GAGCCAGCCG CTCATCAATA CGCATCTGAG AGTACATTGT GGCATTGAAA TTTAATTTCG GTTTCAATTC GCATTTCGCA TTAATTAAAT TGATCTCCTT CTGTGCGAAT TTTTTGGGGG CGGGCAGAAA GTCGCAACAA GACTGCCAAA AGGTCGGCGG CGAAAGTTGA AAGCCTAGGA GAGGAGGATT TGCAGATAAC ACAAGTAGTC AGGTTCCATG AGGGGTTGGG TCAATTCGAC AATTAAACGT CGTCTGGAAA TGATTTGGGA CAAAATCTTC CATGAGGAAG TTCATGGTCA TTCCACCCAC CGTTCTACTT GCCACCTGTC TCTTGAGATG GACATAATCC CGATCCCTGA TCCGCTCGTC GCAGTCTGAT CTAATAAAAA ACCATAGAAG ACGTCGGATT TGCCATCAAA GGCGGCACTA CTTAATTAAT TAATTTATCT GCACGGCTTT GTTTTTGGTG GTGGAAACAT TGCTACTTTG GTTTTACAAA CGCATTGCAC CAATTAGTTT AGTTCAATTA GTTTCCCAAC TTCGAGGCGA GTTTTAAACG CAAGTAAAGA TAAAAGATTA AAACTGTTAG AAAAGGAGAA AAACAAAGCC AAACCAAAGA AGGCCGTTGC TCTTTTTTTC TGCCTCTTTT TTTTATTTCC AATTACCGAG CTTAATCATT AATATTTTTG TTTTTTGAGT CTGTTTTCGT TTCGTTTTAT ATGTGCA