Vienna Tile Information
VT ID VT038335
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200562
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 238335
Nearest Genes
Gene Nr FlyBase ID Distance
CG11671 FBgn0037562 3299 bp
CG7508 FBgn0010433 4556 bp
Sequence Length 2295
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CCCACAAGGTTAGCGGCAATTAGTCA
Right Primer TGAAAGCATCAAAAGGAGTCGCAAGG
Template genomic
Sequence CCCACAAGGT TAGCGGCAAT TAGTCAAACG ATTCGCAACG CATCTACCAT CAATCAACGT AGGGCCATGG GCTCCGGTTA CCGATCCTGA TCATCATTAT CCTCGTCCTC CTCATCGGGA GCAGTAACAA ACTTAACCGT TACCCATTTG ACAAATAATT CGCACGGCCA ACGGCCCAAA AATCTCTGGG TAACTCAATT AGCCACACAG ACGATCGGCA CGGCACACTT GACTGACTTT CGGTTTCCAA ACCCAAGAGT CCAGATTCAG GACCCACCAA GTTGGTGGGC ATCCCAAAGA ACCAAAGTTC TCAGTATCTC ACGCTGCAGC CAACGGTGAT CGAAGATCGA CAGTGAAAGT GCATCAGAAA TCAAAGTCGT TCTGGATTTT TTGACAACTT TTTGGCGAGG CATCAAATTA ACACAAGAGG CAAAAACCTT AAAATGCTAC CAAGACAAGG CACAGAGCAA ACAAAAGGCA GCTAAGTGAA TGCATTTTAA TTATACTCTA CTATTTCAAA TTAAATAATG CAATTAAGTC ACAAGATAAT CCTTGTTACT TTTTATTACC CATAGTCGTA CTAAAATAGG TTTCGATTTA TGATTTAGAT TTGATTTTTT GATTTGTAGC GGTAGAGTAT TCCGCATTTG GCAACACAAA AAACTGCTGG CCAGCATTTT TTAACTGAAA TTGCCACACG CAAGCCATCG CCATCGCTTT GTCACGTTAA GAGGAGAGTC TGAAGAAGAT TTGTCCAGGT CTGCGTCTTC AGGTCGAACA GAGATTACTG GTGCGGGGCC TGTAATTTTG TATTGACATT GGGTCATTTG ATACAGTTTT CCAGCTCATT TGCTTGTAAT TGGGCACCAA AGTCTCGCCC AGACTCCGCA TGGAATCTTC GGAGACTCCC CTCGCGCATT CCCCGCACCA AAAGCCTGGG CTCGGGTTGA CGACTTTTCA AATTACCAGT AATATTGTGG AACTTATATA TTTATTAATC AGGATTTCGT GTGAAAAATG CGTCCAGAGT GCGTTCAAAG TTGCTGCTTG AGCTCGGCTC AGCAGACAGC AACAAGAACA ACATTTTCGG CAGGACCCTT CAATTTAATG TCAACGACGT CGGTGGCGTT GGCATCACTT CATCTCTGGG CCAACTTTGT TGGCCTTTTT TTTCTGGTTG ACAGTAGCTT TGATTGAGGA TGGAGATGGG GTTGCTTGCC ACCTGCATTG ACTGGCCTCC GACTCCGCGC TGTTTTTTTT TTTCGATCGA CTGTCGCGAC CCGGAGTGAG TGAGAACTTA ATCCCTTGGC CCCAATTATT CAAGTAATTA AGTATTAATG TGCGAAATTT TATCACCTGC GGCAAGGGGT GAGCCCGATT TGTGCTGGAC AAGCCGTGAT TTTCCAGCCG ATTTGTGTTT AAACGGTCGT GAAAGTGGGG CTTCTCGAAC ACGATATCGT CGATGAGTTG AGCATTGGAA AAAATGGAAT ATCTCTGAGG AGATCCATAT GCGTCTATTT AAATTGAATT CACATTTAAC AAATAATCAT GTGTGTTATC CCAACCTCCA ATTAATAGAA ACTAGGCTTA GTCGAGCTAG AATATTCTCG GAATAACCAT AACTTTGATT GATTGCCTAT AAAATATCTC GGACTGAACA AGGTGCGCCG CCTCTGGTCG CCCAAGATCT AAAGGATCGT TTCTCGTTCG TGTGCAATTA GCAGATATAA TCCGTGTGAT TCCACCCAAC TAAAATGTCA ATAACAATAA ATTCCTGGCA GCTAAGCGCC GACAAAACTG GCGATCAAGA TAGCAATGTG ATCAGCTCAT AACTGTCAAG AGGAAATCAA TTGATTTGCT CAAAGGACCG GCCCAGCGAA AAGGGATAGG GAAGCCAGAA CCGGCAAGGA TACTGCGCGG ACCCCACAGG ACTTGCTTCG CATAATATTT TAGGGGCGTG TTCCGCCTGT CAACATTTTA TGTTGGTGGT CAGAGAGTCA AATTGTGGTC GCAACTGACA CAGCAGCCCA AGAAAGGCAA ACTGCTTGGA TGCTGGGAAC CGTGCGGGTG TTCCCAGGAC AGGTCCTTGA GCGGACAATG GAACAATGGC GAGTCCTTTG TGAAACAAAG GCCCCTACTT ACAACACATT ATGACACGAA ATCGAAAACG AAAACTACTC GGAATGCCAA CGGGCATTCA ATGGCCCTTC AACGAACTGA TTCATTGCTA TTGCTCTATT TCTGGGGCTC CTGGCGAGCA GCGGCATGTC CTTGCGACTC CTTTTGATGC TTTCA