Vienna Tile Information
VT ID VT063703
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200548
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 263703
Nearest Genes
Gene Nr FlyBase ID Distance
CG33542 FBgn0053542 8957 bp
CG5993 FBgn0004956 20620 bp
Sequence Length 2181
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGGACCTCTCCTCTCCTGGCTCCT
Right Primer TGGTTACAATTGCTATTCAAAAGTGTACTAAGCC
Template genomic
Sequence GGGACCTCTC CTCTCCTGGC TCCTGCTGAA TGAACTTTTG CGCCTGCACA GATCTAATCT AAATGTTCAC TTTGTTTTGT TTCTGTTTTC TGTTCAGTTT TAAATCTCTG GATATTTTGT GTCCAACTTG GCCCGTCACA AGTCACGTGC AGGGAACTGT TTTTGTTTCA GATTTTTTGT GATCTTGGTC GACAGTGCGA CGGCAATTAA TTTAAAATAT CTTATTTCAT TTGTGTGTTT TTCTTGCTTT TCCCCCTCTT ATTTTATATT TAACTTGTAT TCGCCGTGTG TATTTTTGAG TTATGTTTTC CGCTGCAGAT TTCCTCCGAT AATGGCGTTA CATTTATGTT CCCTAAGTGT TCCCAAGCCT CCAGTGGTTC GGTGGCTCAG CGGCGAAGGG GGCGTGGCGC GAAGACCGCC CACCAGGGCG TGTGTCCAGT GTCCAGTAAC TCCAATAGTT CCGATTGTAA AACGATTCGC GTGGAGTTTC TGATTCGCGA CTCTCCCACG AACCTAAATC GCTGGCTCAG CGATTGCCGT CCGCCTGTGG GAATCTCCCG CGCCATACGG AAGATTCTCC AGGAGTGCGG GGAACTCGAG GAGCTGGCGG AGCTGGCGGA GATGTCGGAG TCTGGCCATC TCACTGAGGT GTTGAAATCC CCACAGCCAC AACTCTTGCC CAAGTCGCTG CTCAGCAGTT TCTCCGTTCA CGGAATCGAA TCGAAAGCAA TGCTCCGACC GCTGGCCAGC TGCTCATCTG TTCATCTTTT CATTTGCTCT TGGGCAATCA AATAAAATAT AATAAAATTT CCATTAGATG CGATCTTATT GTAAGCATAA TTGTCGAGCT GCAAAATTCG AGGTTGAGCT CGATTTGCTG ACGACACTGA AAACAGTCAA CTTGGCCAGA GTGCTGGATG GGAAAAAGTG CGACACTTCC CAGAAGTGTC ATCATTGTGG CAAAGGAAGG TCTTCTCCCA GCTAAGGTGT GCCAAGGAGA CTTTTCACTT GTGTGTGAAT AAAATATAAA AGAAAATATA ATACAGGTAC TTCTAATTGA ATTGCAAAAG TTATGTAGCT CAGCTTCGAA ATATTCAAGG TTTAAGTGAC TTTTTGTGCC GTTCCCATAG CGATTGCCTC ATATTTGAGT GACTGACCGA CATGGCCAGC TGTAATTCCA TTAACTTTCT CCATTTGTTG GCCCTCAAAT CGGGCCATTC AATAACCATC TGACCAGGAC ATACGTATAC CCATCCTCAT GCCGTCTAAG CGGCGCCTTG GCCCAAATAA ATTACGATCA CTTAACAATG AGGCGGCATT TTCATGGCTT TTTTTTTGGC GTTTTCATGC AACCTCCCGA ATTTTCCGCT TAATAAGGTC GAAAGGTGTT TTCAATTGCG AAATGGGATT CGTATTCAAT TGTCTGCACT CGAGCGTCTG CACATAAAGT GACACAAATT ATGAAAGAAC CATCGAGGGA TCGATCCACT CACATCAAAG GCGACGCGAC GCGCCCACTC TGCAACGGCC AACAAATGAC AATTGAATCG CCTGCCAGCG GGACAAAGGC GGTACTCACA CGAAGCGGGG GTTGGGGGGT GTGCGAAGCG GTATGAAGCG GTGCGAGTGA GGACGAGGGG CAGCTGGACA GTCGCACAAT GAAGTGATCA GTGGCGGACA ATGGGCGAGC GTTTTTAATT GTCAATGAAT GCCACATCAG CTCTTGACCT TTTGCGGCTA TTTGGGAAAC AGTTGCTCAC TCCGTGCGAA AAAGGTGGCG GTGGCTTCCC ACCCAGGTGA GATCAGATGC AATAAGATGA GATGTCCTGA AAACGAATTC CAATGCGACG CTCTGGCGAT TCAGATGCCG ATTTTGATGG CCATTGCTAC AATGGAATTG ATATAATTAA TGGCCAGTTT GGCGCCAGAC TTTCGGTACA CAAAAAGGGA ATGCGAAGGA CTGCGGGAAA TCATGTACAC TCAGGAAATA TGCGTTTAAG TACTGGATTT AAAAATATCT ATATATCTAT ATCTGTAGTG GAAAATTTCT AAACTCAATA ATATAATAGT AACAATATGT TTCTGAAATT ACTTACTAGT AAAAGATCAA ATAATAGTGA ATTAATAATT GCTATACAAT GTACACTGGC TTAGTACACT TTTGAATAGC AATTGTAACC A