Vienna Tile Information
VT ID VT047418
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200529
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 247418
Nearest Genes
Gene Nr FlyBase ID Distance
CG4719 FBgn0027508 8095 bp
CG17383 FBgn0039350 12361 bp
Sequence Length 3001
ON Targets 0
OFF Targets 0
Viability sterile
Inserted Chromosome 3
Left Primer CTCGCAGTAACCGGGGTGGAAGAT
Right Primer cgCTCGCGCGTTTATTTAAGTGTTT
Template genomic
Sequence CTCGCAGTAA CCGGGGTGGA AGATCCAAGC ATTTCATTTA TTAACATAAT GGAAAAATAC ACTTATTTGC TTTGTTTTAA AGGCAGGGGA ACGGGTCGAC TAATCCAAAT TGATTAATTT TCAGATTCGG CAAGAGCATA ATACTCTATC TGTAAGATGC ACATCTGTAA TGGTATAGAA TCCTATAAAT CCTACATAAA GGACCATACA TATTTTAAAC AATAATTCAC TTCATGGTTT CATTAAGGCG TCAACTGAAA TGCAAATATA CATTATGTAT ATAAGTCTGT GGGATCAGAC GCAATTATGA CTTCGCCACG AATGTGAGCG TCTTTCAGTC AGCGTTCCCC TTGCGCAACT CGGACCTCTA TAAGGGCCAT CATTATCTTA CACAATAGTA ATCTGCCCCT TTAAGGGGCA TATACATATT TCCATTTCCC TTGGCAGACT TAAAGCAAAC AAAAAGGTCC TTAAGTTTTA TTACTTTCTG TATGCGAGAA CCAACCCTAA AGCTTCTGAA AGCTTCCACC TTCGGCCCTT GAAGCTAAAC TTTGATTACT ATCCCAAGGA AATAGTTTCA CTGAGGAAGA GCTATTCAAG CCAGTTGAAC TGTAGGCCAT GAATAATGCA ATGGATAGCT GACCATGCTA ATAAACTATC TACCACCTAA TTTTACGCCC GTCTTAAAGG CCACCCAGAA TCACTGGAGG TGTTTCCACG TAGATTGCTG ATCGATGTTG TGGGACGTCC AACGCACCAT CATTCCCATC CCGGGATATG GCGAGAAAAT ATGTGCCGGG AAAACTGGAA CCTGCAGTCG GAATTGCCGG CACAGCCGAA TGCCTAATGC CAAATGAAGT CTGAGTAGGC ACATCTCCAT TTGACCAAAC TGGGTGGGGC CTCCAGGCCA TTTCTATGTG CGTTGCCCCC TTGTTTACTC CTTTTTCTTT AATAATGCGT CTATATTTCT TAATTAAATT ACAGCTTCTC GCATTTGGGA GTGAGTGTGT GTATGTGTGT GTAATTACAG TGTTTATGTG GCACTCGGAC ATTCCTGGCT CCTCTCTTCC TTTTCCCAGC TGGAGTTGGC TGACTTGGCG TATTGATAAG GCCCAGGCCC ACAAAAGGAA CGCGAAAGGT GAGTGGTATG GGGATTGGGC AGTTTGGAGT TTGGAGCGGA TTGCATCCGA GATGTGAGTG CAGTGGTACA TTAAAACGTC ACCTGATGTA GGCCGTGCCC AGTGCTTATT TGTTGCATTT TCGAAATACA AATTGCACTA GTCCCGGCCT GCAATGAGTG TCGCAGTCGA CGATCTACAC AGTGCAAAAT AATTTGTAAA AATAATTAAA AATAATAACT TCATAGATTT TTTTATTAAA TTAGTTTTTG TGTGGGATCT AATCACTAAT CTTGCAACAA ATTTATAAAA CGATCTACAA ACATATCAAT GTTGATCGTA TCAGCTCCAA AATGACGCCC ATTTTTTTCG GTGCTGCGAG CAGCTTGCCA TTAAGCCTAA CTTTAACTTA ATGCTAACCA CCATGGCCAT AATGTGGTGC GGTTGTGCTG CGTTTTGCGT GCTGCTGTTC GTCAAAGTCA GGACCGTGTT GCCGTCTACT CATCTTGCCA TCTCGAATGT CTGGCCCTGT AATTATATAA TTTAATCAAA TTACTTGCAT ATGTTGCCAA AAAATAAAAA AAATAAGAGA AGGAAATGCC AAAAAACTAA GGCCCGAAAA AGAGACGCAC TGGAGCGGGC CGAAAGACTT GAGAAATGGC CAAATGCGGG CCAACATAAG TGGCAAGAGA AATGAAAATA AAAATAAATG CTTGCGACAG CAGCTCCTGG CGGCTCCAAA ATGGTTTATA GCCGCATTTT TGACAGTGAA ATGTGCCTGC GTGCGTTTTC TGCAGCGGTA AAAGAGGAAA TCGGGAGGGG GAAAGAGAGA TATTTGCGTA CTTTAGCATT CATCATCATT ATTCTTCCGT TGCGGTTGCA TTTTAAACTT TTAGGCGCAG CTTAACGTGT CGGTCGACTT GACAGTTGCA AATTGCAAGC ACATCTGCTG GCGGTCAAAA GCTAGCTGCT ACGCACGCAA TAGTCGTTAC GACGAAGCTT TCGTTACCCT CTATTGGGTT CAAAGTTAAT CACCTAATAG TTTTCCCAAA GTAGCGTTAC TAAAGGAAAA AGAGAGAGCT TAAGATAATG AAATGACAGT AAGCTTTAAC ATTGAGCGAC ATAATCGTTA GGATGGAGCT TTCGTTACTA ACTACTTTGA TCAAAGCTAA TAAACTAATA TTGAAGCCAA AGTAGCCTTT ACTTAATGAA ATATGAAGAT GGTTTAAATT AGCATTCTAA AATGAAATAA AATAAATACA GTGTAGATAA GGCTCTATAA TATACATTTT AGAATGTGTT TACTAAAAGT ATGATAACGA AAAAAAAACA TTGTTTAAGA TTTTTATATT GCGTTTATAG ATGTAAAAAT TAATTTGGGT TACATAGGTG AAGAGTTCAT CTCTCATCCA ATTCTCAAGC AATCATAAAT GCAAAATTCA TTTTAAAACA AAGTGTAGTG ACTGAAATTG TTCAACTAAA AGTTCAATGT CAAGCAGATT GCTAGTTTCA AAATTAATAA ACATATGCCT ACGTATTTAT ACATCACTAC CATGACTGGG AGTCATTCTC CATATGGCCG GATTATAAAT AGAATACCGC ATATAGTTTT TGACCCTTGC TCTTCACTGA TTGCCTTCTG AAAATGTTAA GGCGCCATTT TAGTGAACCA ATTGTACTTA TTATTAAATT TATAATAAAT ATTCAAAACA AATGAATTCC GGTTATGAGA CATATGAAAT AACCCGCATA ATATATTGCT TAAAAAGAAA AAAAAAACAT TTTTCGATTG ATGTATATGT ATTTGTATAT TTAAATTTAA TTGGAGTTTT AATTATTGTT TAAATTAACT AAGCTTAAAC ACTTAAATAA ACGCGCGAGC G