Vienna Tile Information
VT ID VT025338
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200511
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 225338
Nearest Genes
Gene Nr FlyBase ID Distance
CG14994 FBgn0004516 9637 bp
Sequence Length 3389
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGAATGCGCTTCAACTGGTACTGGA
Right Primer TCGGATGAGCACGGCAAGATGA
Template genomic
Sequence CGAATGCGCT TCAACTGGTA CTGGACCAGC TCCATGAGCC GGTCCTGCTG CTGCTCGAAG CCCTCGGTGC CCTTGGCCCG CCACTGGAGC CACAGCTTGA AGATGTCGTT GTGGCGGCCG CACTGGATCA CCTTGTCGCC GGTGTCGTAG CTAATGTCAT ACTGCTTGTC GGTCATGAAG AGATACTCCG CCGACATCTG ATTGCAGCTG ATGAGCAGGC CCTGCGTGAA AGATGTACAA TAGATATACG AGTATGAACA TATCGATTTG GGATGAAATC GCTCACTACG CAGCAGACGT AACTCCGCTG TCCATAAGTC AAGCTGAAAT TTTAATTAAA ATTCCGCCTG CCAAAAGACG CAACTGTGAC CGATGGTAAC ATATTGCACG GGATGTAAAA AAGCCAGGGT GGTGACTTGG CGCATTTGGT TCGTCAAAGA TTTCATTACG CATTGTGTGT GCGACTACCC TTGGCCATTT CGCTCCTGGT TTGGCAGAAC GAACGGAACG AAACAACAAG GAATTGTTCG GAGTACAATT GGAATTCTTT ACACAAACAT TGTTCGATGT GCATCCAGAA GAATTTTGGG TGAACCGTCG AGGGGGAATG GGCCGGTTGG AAAAGGAATT TAAAGCATGG GGTTGAGCTA GGGGTATGCC TCCAATTTGT ATCGCTTGGT TTGAGTTTCT GCGGGGGGGA TTGGTGGTGG AATGACTCCT CCGACAGGCT GGCCTTTAAT TTTAATTTGC AACTCAAAGA GCAATTATTC GTTTATTACT TTGCAAACAA TGATTTCAGT GATTTTGGGT AATAAAATAC GAAAAATGTG AGGTCACAGC TGTAAAGGAT ATACAATTTC GTTTGGTTGG TGGGGCTGCA GAACAAATTG TACGTTGCAT ACTTTTGTAA CATGGACTTA AGCCACAACT CCCATCGAAA TTCCACAAGC TCTGCAAAAT CGATGCTACC ACTTTCTAAG CCTTGAAATC TTGCCAAACT TTATTTAAAT TTAAAAAAAT GTTAAAACAC CTAGCATAAA TGATTTAATA AATTGATATC TCTGTAATAG TATACTTACA TCCTCCTTGA AATGGATCGT GGAGCACTGG AGCAGGGCTC CCATGAGCTT GTGGGGATTC CAGGTGACCG AATCGGCACT GCAAGAGTTA AACGCACGGC GTTAAATGGA CATTCAATTA CGAATTACAA ACAATTAACA CTAAGCTGCC GCACTGCGGT ACAATTCCCA CTCCCAAGGA CACCAATCCC ACCCCCTGCT GTTCGACAAG AGTTCCAAAA AAAAAAAATC TAATGGGGGG AGGGATGCGG AAGGTCCTGG CAAGTGCCAT AAATTGTGGC AATTTCAGGC CGCAGCACTT TAATTGAATT CAAAAGAGCG AGGACAACCC CCTGCGGCAC TGGAGGGTTG ACATTGACAG CTAAACATCC CTGTGGGAGC TATTTACAGT TATGTGGGCA CTGAGAGTGT GTGCCTGTGT GTGGGCTGGG CTTGTAAGTG TGAGTGAGTG AGTGGGTGTC TATAAACATG ATCCTTATGG AGTGCCTTGA AGTATGCTTC ACTTTTTCAA GCAGTCTGCT GCTATGGGAA AAAGGGTATA TGGTTTGTTT TAACGGTTTA GCATATAACA AATAATTTAA ATACTATAAT ATTAGTCATA AACTTATAAA GAAAGTATTT TAAATATTTT GTTGCAGTAA ATTTGAAATA AGTTTGAAAC TCTGTGCTTT AATGTAGATT GACTTCAAAC TTAGAGGAGT ATCATTTAGT CGTAACACTT TTGACGTCTA ATGCTTATTT GATTGAGCGG TGGCATGTGA AGCTAAACTT TTAAGAAGAG ATTTTCGATT GTTTTAAGTT TGTTCGCAAA TTGAAACTCA GCGGATTTAA GAGCCTCCTC CATCGAAGGA CCATTAATCA GTTGCGTAAG CCGCCGAAGG CCACAAATTG TCAGCTGCAT GGGCATTTTA ATGATTAATT CGCGCTGAGA GCCTTTCAAT TAAGGACCTC GATTTGCATG CCACAACAAT TCGGGCCTTA GGATCCATTC AAACTAATTG AAGGCGTTCG CCTGGGTGAT GGATGGACGG AAGGAAGTCG AAATGGGAAC GGGAGTGGAT GTTAAGTCCT CCTCCGTCGA TGGCAATCAA TTTGAAAGTG TTCTGTGGAG TCGGCTGCTT GACCGCAAGC TGTCGATTCC ACGACAGCTG CACTTGCCGC ATTTGCCTAA GCTTCCCGAA ATGCTGAGTA GAATTAAAGA TGTTATATGA ATTGCCGAAG TAAATGGATT CGGGTTGGAA ACGTAGGTCG TGCTGGAGAT GGAGTAAAGT GCATTTCAGG TTGCGACTTT AAAATTAAAA ATTCCTAGCC CCGGGGATGA ATCCCTATTC CTGACTTGCC CGCCCATTCA TTGTTTGGCG TAATTGTTGT GTAAGTAATG CCCATGGCCA TCCAAAACAC CCCCCTGGGC TAGATGGATT GGTTGGGAAT GGGAGAAGGG GAAATCCACT TTGTTCATTT GTTTGTTCGG TCCAAAATGC ACTCGGCTTG TGAATTGTAA TCCCTGTAAG CTCTGAACAC CTGATGGAGG CACTAAATGA CAAATTGAGA TTTTTCCCAC ATGTTCAGCA CGCCGCCGAC CTTCAAAAGG GGGCGGCAAA GTCGAGCGAT GCGGGCCATT TGGGAGCATT TAGATTTAAA TTTACCCAAA CCGGGAAAGA GATTTCAATT TTTTGTTTTG ACTGGCCCTG AAGATGAGGG CGCCCAAGGC ACAAAGTTCA TGTCAAGAAC GATGATGAAT GGGCACAGCA ATTGCTTGGG ACAAAAGATA AGGTTTTCCA AGGGGTTTTT AAAGCACTTC TGAGCAGCTC ACTGGAACTT GAAGGAGTAA AAGATGGCTT AATTTGCTAC ATAAAAAGTA TACCGCACTT AGAAAATTAC TAGGACTTAA CTACTACAAC TCCAAAAATA TTATTTGAAA AATGTAATAT ATATTTTTCT AAAAACTTAC CGCTCAACAC CAGTAAATCT GGGATGACGA TGCTTACGCG ACATCAACAA TCCACCGCCC CAAGCAGCCT GGAAAAAATC AGAAAAAATT AGTAATTAAT ATTACAATAT ACGATCCTTG CAACTATTAA GTATCTATTG TTTTTTTTCT ACTCAATTAG ATTGTTTTGT TCTTACATCG ATGTGCATCC AGCAGTTGTA CTTCTGGCAG ATATCCGCAA TCGTGTTGAT ATCATCGAAG GCACCCAGCA CAGTGGTGCC GGCAGTGGCG TTCACAAAGA ATGGAATGTC ACCCTTGGCC TTGCGCTCCA GGATCAGGCG CTCCAGCTCC GAGGTGATCA TCTTGCCGTG CTCATCCGA