Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT056873
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200424
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 256873
Nearest Genes
Gene Nr FlyBase ID Distance
CG12212 FBgn0003053 7089 bp
CG12684 FBgn0029717 36476 bp
Sequence Length 2126
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTCGTCTGGGAATGTCAGCCTTGGA
Right Primer TGGTCCAAAGAAGGTGGTTTATGTGC
Template genomic
Sequence CTCGTCTGGG AATGTCAGCC TTGGACATCT CAAAGTTCGG TTGGCAAACC GATGATAAGC GGCCATTTTT GGCAATACTA TTTTTATTAT TTGTTCTACG CTCTGCTCTC TTATCGCCAC CGAGTTTAAA ATGATTTTTC TCATTAATAC CCAGAACAGA AATTCAATTA AAGCACCTGC GATGGACGTG GCTTATCAAG CAGCCGCCCA CAGGCACCAA CGAAACCAAA TGAAAAAAAA AAAAACAAAA AAACCTTTTG GCCTCGGAGG GAGATATAAA TGTATACGAG CGATTGCAGA GCTGCTAGTT CTATTTTGGT GCCTTTTTCG TGGACACTCT GGGCTGACGA AATCTGTGGC ACCTTCGGCT CGCCTCTATC TGAAAACCCG CAACCCCCAC TCCGTTTACC CGTTCAATGG GTCAGATGAT TGATATAGAA ATTGTTGGTG ATTACTTCCA TTTGGCGTTT CTCAATCGGA ATCAGGCAAG TGCCAAAAGA AAACACAATA ACTTTGAAGA TAAAAAAAAA AAGCCAGAAA GCCAGAAAAA CCCGAGAGAA AAGATTGGAG TGGCGTGAAG TTATATAAAA CCATGGTGAA CGGTACCCAT TTCGGCGGGG CGTTAATATT ACGAAATAAA AAAGGTGAAG TTTCAGCAAT GTTCTTGCGA AACTAAATAC GAACTTCATC GCTTCATATA GATCAAATTT TTTTTCTCTG TGCAGAATAC CTACATATCT GCGTAGCTTT ATCTCAACGA CGGCTAATGA GTTGTGAGCT AATGACATAC GGGGTGGCAG TTGAGTGGGG TGTTCTGAGA CAACGGGGGA GCACAAATCA TCTGTGGCCA ACACCCGCCC AAAGTTGTGA AAATAGGCCC CGCGATAAGG GAGTGTGAGG TGTGCAAATA CTTTGCGTAG TCGAAGCACC GAACCACCTC CCACATTCCC TCGCCCCAAA AACACACCTT TTGCACCACC TACGCATCCA CATCCGCATC TACATCCGCG TTATCAGCGG GACAGCGGGC GGCTCCTTTG AAGTTTCCAA AGGGAGGTGA TGGGCCATAA TAACTGGCCC AGATATTACA GTGCAAAACG TAGTGTTAAC GATTGGGTTT TTTGGCCTAA AAAAAAGACG AAGAGATTGG CTGATTCAGG AAATCATCTT ATATTTTAGG GTTAATATGT AAAAATGCCA GCTATAAAAT AGCAAGTAAA TGAAAATTAG GAATGGAAGA TTACCAAATT TATGAGCCAC GCACCTTTTG GCGATCTAAG CGATGACACT CTATTCTAAC AATCAAAAAA AGTAATTTCA AATCTGTTTT AATATTTACC CACCGCCACA TGTGCCAAGT GAAATAAGAT GTTGCTCAAA ATATCTACAG AGATGAGAAA GTCAACAAAT ATGGGTAGAA TCGAAGGGGT GGGAGTAACG ATGGGTGTGG ATGGGGTGGT GAAATGTATT GTTTACCCAG CTTATTAGCA AACATTCTTA TCAGTCAACT CAACTCGGCT CAGTTCAGTT CAGTTCCGTC AGGTTTGGGT CGACATCGAT GACGATCATC GTTTACCATG ATGACAATAA TGAAGATGAT GATGGTGCGA TCGAGAGATG TCTGTGTTGT CGCTGGGAAA ACAACACTCT GGAAACAAGA AAAAGTGACG AGACAAGGCG CGGCGAGACG GGACGGCATC GAGATGCAAT AATCGATAAT AGGAAACAAA AGCCAAACGA AATCCAATGC GTCCAAGGAA AACACACAGT ATCTATGAGA TAGAGATACA GATGCAGATA TGTACTCGGC GACACATGCG AGGCAAAAAT GCGATTATTT GCTTAAGTGT AGCTCGATGC GGCTGAAACC GAAAACTCCA GTCGGCCAGA TACAGATATA GATATAGATA CATACCGATC AGTTGACAAT CAATGTTCAA ACAATAAAGC CGAAAATGAA ATTGAGTAGA AAAAAGCCAC ACAACTTTCA ACGTTTATCT TCAAAAAAAA AAAAAAAAAA TACACAAATA GGGCGAAGCA GTGCCTCAGA TTCGAATACT CAATCAAACA ATCAATCCAT CAGTCATTTC GTCAATATAT GCACATAAAC CACCTTCTTT GGACCA