Vienna Tile Information
VT ID VT055826
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200415
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 255826
Nearest Genes
Gene Nr FlyBase ID Distance
Sequence Length 2103
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGAATTTCGACGGTCAACTTATTCTATGTC
Right Primer TGATGATCCCATTTCAAGGGAGAAAA
Template genomic
Sequence CGAATTTCGA CGGTCAACTT ATTCTATGTC TTAGATACTT TAAGCTTAGC CACTACAAAC GGTTCTAGTT ATTAAAGCGG AAGTTAATCC ATAGAGCGAT ACCTCGGTTG GTATACATTT GTTAAGAGTG ATCATAGGAA CCGTTTGTTC TACGTCTTAG ATACTAAAAT CGCATAGTTA ACTAATAGTT AAGGGGTGTA CCATACGTGC ACCCTTACAT TTCTTGATTA GCACTGTATT CTCTACTGGA TTCTAGATGA ACCGAAACTA TATATCCTAT ATATCACTTA CGGCACTCCT CGTTCTCGTC CTCGCCTTCG CTACAATCCG AAACGTTGTT GCAACGCTTT CTGGCATCGA TACAATCGCC ATTATTGCAT CTAAACTCGT TGGCCTGGCA CTCTGCAAAT ACATAAAAAT GGGGGAATTT TATATTTGGA ATGTCAGATG GATTTGACAG CCTGCAATTA GATGACAACC GGATGCAGTT TAACAAGGAC TTCCGCCGTC CGATGGAAAT ACATCTCTAC ATCTCCGACA CCCCCGTCAT CAACTTGAAA GCAAAAGTTT GTTAGGTGTT TGTTGTGTGA CAGGACTGGG GTATCCCCGC CCTCGTTAGC CACAGTTTCC TGTGCATGTC TGTTGGCCTT TTGAACCCTT TTTTCCGCCG GACTCCGCTT AATATTTCAT ACAGGAGGAG CAGCAGCACA AGACTCTTAA GCAATTTCAC AAATATTTTT GGACAATTTT TTTTTCCAGC CCCATATTCA AAGTGACACA ACGCGGATTT GATTACAAGC AGCCGGAAAA TTCGCGCAGA GGGGTATAGA TAACAAAGGG AGAGAGAGGC AGCAGAGCCG CGAGCAGCGG CTAATTAAAA GCAAAGAAAA GTTAAGTGAA CATTTAAGGG AGTGGGGGTG TCGTAATCAG AGGAGCTTAA AGTAAATCCA ATTCAGAAGC AAACAATAAG CGATGATTTC ACTTTGTGCC CTCCACAATG TTTAGCCATT TAGCTGTAAT AACAACGACT TAATTTAAGA AAATTCTTAC CATAGCCCTG TGTGTACAGC AATCGTTAAA AGCCGCCGAA ATAATTGCTT ATATTTATAA ATAAAATTTA AACTGCATTT CAGGGACTGG GGGTTATTGG CCCCCGCAAG TCAACAATTT GTCATCGCGA ATGTGGCAGT TAATGTGGAA CTGCAGTGGC GAAAACTTAA GCAACTTTTG GGCCGCACAC AAATCGCCAA AGTTTTCCAT TCGGCAATTT TCAACACGAA GGCGAGCAAA ATTCCGGCCA ACAATTTGAC AATTTCATTG CGGACAGACA GACAGACAGA CAGGCAGGCG AAAAAAAAAA AGTGAGGGAA AGGCACCTGC ACCTCAAGTC AATTTGCAAA CGGAGGGCAA ATATGATTTT TCGCTGGTGT TCCTTCTTGG CCTCTGTTTG TTTTTATTTG CCAACTGCCG CTTATTGACA TTAAAGATTC AAATAGTGGG CGAAAGCAGA AGGGCATACA AAGGATTTTG GCTGCCAAAG GTTGTTGGGC TCCAATTATT TGGCCAGACG TGTGATCCTA ATCCATTTGA CGGCCCACAC ACAAGCTACA AATTATAATC CGCAGTCGGA AAACAAGTTT TTCTTTCGTG CATTTTCTTG ATAAAGGTGA AATGCGAAGG GAATGGGTTT ATGGTCCAGC TGGGGATTTA CTCCTTTCAC TTTTTCTTAT TTTTTTTGTT TTTTTTTTTG CAGTCGTTGT TATTTGATCA ATTTAATAGG TGTTTTTTTT TTTTGAATTT CATTCCTATT TAGTTTAGTT TTAATCTACA AAATGACAGA AAGGAATCTA TGGCAATTCG TTTGGTGCCA AAGTGACTAC ATTAAATATT GGTTATATCA ATTACTGCTT TCAGCATTCT TCGTGCCCAT AAATTTGTCC CTAATGACTG TTACCTGCCA CTCAATCCCG CATTGCACTA TTTTGCAGCT CCTTTGGCTC CACTGTTGCA TTGCGTCCTC CTGAGCTGAG TGTCAAATAG ATTTTCTCAA CCGAAGGAAA GCTTTTACAT TCTTTTCTTT TCTCCCTTGA AATGGGATCA TCA