Vienna Tile Information
VT ID VT044107
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200398
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 244107
Nearest Genes
Gene Nr FlyBase ID Distance
CG3619 FBgn0000463 9548 bp
Sequence Length 2242
ON Targets 0
OFF Targets 0
Viability lethal
Inserted Chromosome 3
Left Primer CCGATTAAAAACAAAGTGGATTCACAAAGGA
Right Primer CACGCAAAATCGAAAGTTGGTCGAAA
Template genomic
Sequence CCGATTAAAA ACAAAGTGGA TTCACAAAGG ATTTACTTCT AATTACTAAT TCTAATTACG TTTGTCATTA AGTTATTAGG CCAGAAATAA ATAAATATTC TTAGTACGGT CAGTATCAAG TTTGCAGTTT TCTCCCAGTG CCTCAGCCTT CGAACTTCAG TTTCAGATTC CTTTGCCCAG CAGGTCCGGT TCCTTTGGCT CTTGGCCATT TAAGTTGGCC TCCGGCTCTG GGCGAAAACC TGGCGAAAAG GTCGCCATGT GCGTTGCACC ACCCCTCCTC CGCCCGCTGC TATATGTAAT TTATGTTAAA TGAATATAAC AAAAAAAGAG CTAAACTCGT TGGCAAAATG CTGCGGCGTA AACTCGCTAT GCAAGTCCAA GTATGCGGGA GATCGTCATT CAGCGCAAGA AAAAAAAAAG GAGGAAAATG AAACTAAGTT GCATACTTTT AAATAATGAA ATTAATCCTT GACAGGCGGC GAGACTAGGA AATCTCGGTG TGCAGAAATT GAAATTGCAA TTGCCGGCGG AGTTGGGGAG TTCGAAATGT GCTCATGGGG ATGGACTCGG CGATACTTGT GTACCGATAA AGATCTATTA GCCTGGGACC GCCTCGGAAA TTAGCCTGTA GTTGAGGCGG CACAGCGGGA TGCCGAGTGA AAATCGGTTA AGGAGCTCCC AGCAAAACAA TTAAAATTCC TTGAAGGAAT AGGCCAAGCT ATATATAGAA AAATCGAAAA GGAAAAAAAA GGGCCTGGCG AGACGAAAAA CAAAGAGAAC AACATGCTAG AAATTCCTAT GAAAACTCCA TAAATCTCGA AAGCAAAAGA AAGTGCAGGT AGCTAAGCCC CAAGCAGGTA GCTTCTCCTT CTCCGCACTT CAATCAAATT GTGTGGGAAA ATCAGCCACA AAAAAGTGTT TTTAAAAATC GGAGCTAAGG AATTCTGCTT TTTGGGCTGT TGAAAGAAAA ATCGTTCGGC TTTGTCAAGG ATTTGTGAGC TGACTAGAGC TGGATCCTTG TGTGGTCCTT ATCGCTGGAA GACAATCAGT TACTACACAG AGATTCATGT AGCATTGTTT CCAAGATGGA TTACACACGA TCTCGGTTCT CTCGATCGTT ACAATCGGAA TCGCATTGGA CTAGTACAGC GTTTAGTTCG TGAGCCCGAG CTTAATTGCA CATTTCAGGC AAATGAGGGA TGGCCAAACC TCAACTTCGA GCACACTTCC GTTCCAAAAC AGGCAGACAA CAAAAGGCGA CAAAGTCTGG CCCTCGATTA TCCCCCATGT GTGTGTGTGT GTGTGTGTGT GTGTGTGTTT AGCTGGATGG ATGGTTGGTT GGTTGGATAT TTAAAACCAC TCAATACCCC GGAAATCTTA CACTGAGCGA AGAGCAGCAA AAGCTAGAGC CTGCCAAGGT ATCAAGTTGC GGGTCTGTGC GATCGCTTGC CGCTTTTTTT GACAGCTTTC GATCACAGGA AGCAGGATGA TGAGCTCATA ACTTTTGCCC ATGTTTCAAG GAAGTAATTT CACAGCCTAA AAGATTTTTG TTATTGAATA TGTATTATAG GTTAAACTTA CTGTTGGTGC GCGCATTGCC GCTGTTGTTC GTATCATGCC AGGCCTCGAC GATCAGCGAG AAGGTACCCT GTAAATCGGA AAGAAGAAAA GGAAATGGTT AAAGAAAGTT CAAATCTAAA CGGGAAATGA CAGGCACTAA TGCCATCCAC ACTTATCAAA TCGTATCGAC TATAACTAAT TCCGAGCTAA TGGAAAGCTC CCTAGAGCTC CATCGCCCCC ACAGTGAGCA CTCATTATAA GGAGATTATG ACAGGCGGCT AGGCAAGTTG GTCGCCCACA CGATACCCCA AACGCCCGAA TGCCTCCCCG GACCGCCGAA TCTAATGCAA TGCGAATGCA TTTCAAATGC AAATCGGCAA AATGCAACTT CGAATGCAAC CGGCAGGCAG CGCCCTCAAT TCACACTTGA TTTCAAATGC AGCGCTGCTG GAAAAACCGG CAGAGATGAC ACAAAATCCA AATCCGAATC CAAAGCAAGG CGAAAACCAG CCGATTGAAA CTTTTGCAGA GGTGTCTCTA CTGCTACTAC TGCTGGCTGC AGCGCTTGGT TTTCCATGGG TGTGTGTTTT TTCTTGGCTT GCGTAGAGCT ACGAGTTTGG AGCTCCGCGT TTCGATTCGC TTGTAAATGA CTAATTTTTC GACCAACTTT CGATTTTGCG TG