Vienna Tile Information
VT ID VT056876
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200380
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 256876
Nearest Genes
Gene Nr FlyBase ID Distance
CG12212 FBgn0003053 1889 bp
CG12684 FBgn0029717 41679 bp
Sequence Length 2123
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CATAAAACCCGGTCTCTTTTGGGGG
Right Primer ccaacgccaagcacaattacaacaatatAA
Template genomic
Sequence CATAAAACCC GGTCTCTTTT GGGGGAACAA ATATATAGAT GTACATGTGC ATGTCCATGT GCATATGTAT GTATGATGGC ATGGAAGCAT GGTACCATCT ACCTGCTTGA AGAAACGCGG CGCGTGCGCT AATCGGCGAT AGTTGTCCAA CCCAAAAATA TCTGCAAGCA GTGTATCTGT ATCTCTATGG GTGCACAATG ACCCAAAATT GATGGCCAGA CGCGATTCCG CAGACCGGAT CTCACTTCGA CGAGTGTCGT TGATCCGGCA AAGTCAATTG GTTTCTAACG AGCTTAGCTC CTGTGCAGAC AATGTCTGAG GTTCGGGTGT CGTCGCAGTG CCATGAATGG TTGGGTCATA AATGCAATAT TAGCCAAGTT AGTAGAAGAA TGTATGAGGG AAATCTCTTT TAAAATAGCA ATTGATATTA ATTATACATA TGTATGTACA TACAATATGA TAGGACACCG TCATCATTAC CTGTTTTGTA CTTAAACGAC TGATATGCAG CACCATATCA GCGTGACGTT TTGAGTTCTT AAAAAATGAT AATTCAACAA TGATTTGATA CGAAATTTCC TAAATCCAGT GATTCGAACA TTTTCCGCCA AATTCAATCG GCTTACAACT GCCCCATTGA ATGGGAAAAG CTTTGCCCAC TTGTTGTGTC ACACACACAT TTATGTATAT ATTTTAGTAT ATTTGTATGG ATTTATAGTT TGTGTCTGTG GCAATAAACA CACATACACG TAACACCAAA CACAACACAC AAGTTGGGGG GGAAATTCAC CGAAAAGCAA ACTGTGAACT GACGCATTCT ACCAGCTAAC GGCATTTGTT TGGCCACAAG TCGCGAATAC CTCGTTTTTT TTTTATTCCA GGGGCATATT CTCAATTGCA AGATAAATAC ATATGTTTAC ACAAAAAAAA AAAAAAACGT TCGAAATTCC ATGCGATTGA GCATTTCTCT TGTAGAACAA AGCAAAAGTT AAAGCATTTT ATAAAATATT TAAGTATAAG CCAGGGTATT AGCCGCCTTC GCACTACGTA AACCCTGTTT TCTGCACTAT TATTCTACAT TTGTTGTTGC CGTTATTGTT GTTATTAAAC AAGCTGTTTG GCTGGTCATA TTGTTATTGT TCTTTTGCCG TTGATTTTAC TTTTTTTGCT TTCGTTCGTG GCGGGGGTGC AAAGTTTAGG CAAAGCAGAA AATCATATAA AATTTGAGAA ACAAAAAATA ACAAAAAAAT AGGCGACGCG CGCCTTTTCA ATAACCTTTA TCAGGTGGGT GACTGTTTTC TGTGGGCGGA ATTGGGTGGC GGCGGGTGCC CAGTCACCTT GACATATCAC TGGTGACAAC AGTAACAACA ATAAAAACAA TAACAAATTC GCTGGCAAAC GAGTGCGAAT TAAAACGATT AATGGCGCTG GCTTTGCTTT TGCAAATAAT AATCCCAAAA CGAAAGCGAA TTTCAGGCAT TGCAGCCCGG TTACACTGAG CAAATTTTAA GCTGCAAACT ACAAGGCAGG TAAGACAATT CAAAATATGA TCAATTTATT GCCGGGCTTC AACAAGAATC ATCTAGTTTT TGTAAAATTG TTTCGGCAGA ATGTCGTTAC TTTTCTCGCT CTGTAAAATA TACCCACAAC CAAGTTACTA AGTGATAAAG AGCGCAATAT TATGTGGAGC AGTGTTGTGA AGGGTGTGTG AGGTGGGGGG GGGGGGGGGG AGGTGGAGTT TTCAATGTTG AAGAGCAGCG CGTGGGATTT TCAGTTGGCA GCATTGTTTG CTATTTGTTT TATGCTAAGC TAAATGCTAA CTAAATGTTG GCAATTAAAT GTTAATGTTG CCCCTTTCTG CCGCTGCTTC TTCTTCTGCG TCGACTGCTA CTATTTGCAA CGCCAACACT TTCCGTCTCC ATTGAAAACG GAAAAATTGA AAAAAAGGGA AATTGATACA GAAACTGAAA ACGAAACCGA AACTGAAACA CTTTGGTTTG GTTTCTCAGC TGTTTGCATA TGGCAAAAAT GCAATGCATA TCATATCTGG CTGGCTTTTA ATGTATATTT AACACGCATT GCCATTACCA TCATTATATT GTTGTAATTG TGCTTGGCGT TGG