Vienna Tile Information
VT ID VT014208
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200337
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 214208
Nearest Genes
Gene Nr FlyBase ID Distance
CG1794 FBgn0033438 8875 bp
Sequence Length 2139
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCACAAAACCCAAAATCGAAAAACGAA
Right Primer TGGTAAAAGAGCGGAATACAAAAATCCC
Template genomic
Sequence GCACAAAACC CAAAATCGAA AAACGAACAA GAAAAGAAAA AAAGAACAGG CGGCAGGAAT GAATCTGGGT CAATCCAATT GTTTTATATT CTGTTTATGT TTTTCTACTC TGTGCAGCTT TTCGTGGCGC TCTTAGAACT CCAGCAAATC CACCAACGAA TTTCTGGCTT GGGCTATACA TATATATTTA TTTATGCACT TCCACCTTTG CCAGCGCCAA CCTCTTGGAT TTATTGCGCT TTTATTCTTC CTGCCATTAT AGACCGTTGG AAACAAATCT GCATGCGGGT TTTGAGTGTG AATGCATGTG TTTCTCCTAA TGGCTGGACG TCCGTCCGGA TCTTTTTGGT CTTTCAGCTC CTTTCAGCGC TTCACCCCGA GTGTATCTTT TAGTCCTCCT CGGGCTCTGC GTAAGTGAAA TGCAAAACAG ATAAAGCTGA AACTCCCCCC ACAATGATTG TGCAATTCCG ATAATGCATT ATTCGCTTCT CAGCACTTAT TTGAGTGATA TGCTCGAGTG GTAAAAGCAT AAATTCATGA CTGTTTAGAA AATCACTGAT TGCTCTGCTT TAATGCTCAA AAAGCCACCA AGCTAAACCT TTTCTCGAAC TTTAATAATT ATAATTAGTT GGTATGAGTT ATTAGTATCA AGACATAAAA TCATTATGGT AATATATTTA AGCTTTATAT ATTATGACAT AAAATCATTA TGGTAATATA TTTAAGCATT ACAGCCACTA TATTTATATC GTTCAATAAC TTATTAAATA TCCAAACCCA AAAAATATAC CTACATTATC TTTCAGATAC TTTTTCTGTC AATTAAAATA TGAGCTATCG GATTTTTCGA CCTGGAATTT GTCCTTTATT CACCTCTTTG CGGAAATGAA TCATGGAAAC TGTTAACCAA AATTGGGGAC AGCTCAGTAA ATGTAAATAC CATAAGTATG AATGTTGCTG AAAGATTATA GAGGACTGGT CGTCCGTACG GATGTCAGCG CTGGAGTCCG CATCCGCATC CGTATCCGCG TTGGCGTTCC ATCGGCTAAT GTGCATGCAG ATTGAGTTTG AGCGCTGGTT GGCAGGCAGA CTGTCAGAAA TTGTGTATGC ACAACAAATG TCTCATATTT TTGGGTACGC AGCCATAATG ATGCATAAAA TGCAGTGAGA CAACGAAAAA AGCAGCGGAA AGCGAAAGAA AATCAACATA AATGCATCAA TCATACGCCG CGTGGGTCGG CCAGACGATA ACACTTCAAT CTCCACATTC TCTTTATTCC TGTCTCTGAA TTTCCCATCC CCCGAATGAC ATTAAAAATC AATCAATGGC ACATTAAATT AATAAATACG ACAACAACAA TTGAGATCGG CGGGCTACTG TACATGATGT TCTGCTTGCA GGCTTATCGC CCAGCTGAGT GTTTTCTTTT CGATGCGCTT TTTTGTGTTT TCAGTACAGA TTAATTAAGT ATATAATTCA AACGTATAAA AACCGTAATG CTTCCTATTT ACCCGCCTTT GTATACATTA GCTTAAGCGA GCACGTTTTC ATTTCGACGC CGTGTAATTG CAAGGAAGAT GGCATTTCTG AGATCGCAAT TAAAATCAAA AGATAATGAA TGGTCGAGTT CCTCAGCTAA TGGGAGTGCG AGGGGGATGG AGATATTTTA GTTGCCTACT TAGACTGCTT ACAAGAGCCG CCACCTATCG GCGGCTACAT ATATTTCTCA TAAATATCCG AAGTCTTTAG TCCATTGTGC GTTATAAGAT CCTTATTTTT TAATATCCTT CAAATGTTAA ATGTTACTTG AAACTGATAG TTCGTAATCC TGATCCGGAA CATATACACT TATATTAAAG GCCGGAAACG GATCCTAGCC ATTACGTACT TTCTAGCATA TGTATTTTAC GTATTAAGCT TCTGAAGATC ATGGACCCGT ATATTTCTTC ACAAGATTTC AAATTTTTAT TTATTAATGA AAAATACATA AGTTGATCCT GTTGTAAAGA AACTGGATGT CATGTTCTCG ATCAAATCCC CTTCCCTTAT TTTCCTTTTT CCACATATAT GTATATATTT TTTAGCACAT AAACTACCGT TTGGTACTAA CGGGATTTTT GTATTCCGCT CTTTTACCA