Vienna Tile Information
VT ID VT003280
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200327
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 203280
Nearest Genes
Gene Nr FlyBase ID Distance
CG31637 FBgn0051637 11792 bp
Sequence Length 2167
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer AAAGACATTCCTTGTCAGAGAAACACTATGGA
Right Primer CTGCCACATCCGCAATAATCGACA
Template genomic
Sequence AAAGACATTC CTTGTCAGAG AAACACTATG GATATTTATA AATTGTTAAT GAGACTTTGC ATATGGTCAG TAAATTAAAA GACATTAGAT TCGAAAAGTA TCTTTAGTTT CGTCATTTAT ATAAAAGGTT TATTTAATTC ATTTTAGTGA TTACTTAATT AAAATACCTT TGAATTGCTA TATTATATCA GTATTGCTCT AAATAACTTT AAAATTTTTG CCAAGACTGC CAAGGTCAAG TGAATTCGTT CAACTTTGCT ATATTTATTA TCTTCCCTAT TAGCAGATAG TGTTTTTTAA TCGGCTGTTC CCACCGCAGC CCATATTTGT GTACACAAAA TTCATTTGTT GAGGAGGTCT GCGTCCAGCT GCGGTTATTG GATGGTTGTT TATCTGGCCA GCACATTTTA GCTAGCCAAG TGCATAAATA CTTGGAATAC TGGAGGAACT AACCAGTAAA TGGGTCAGTG AGAGGTTTCA TTTGGTGGGG CACGTCGTAA ACGTCTTATT TCTCTCACTC ATTCCGCCCA GTAATCTTCT GCTGACAACC TCTGACAAGT AGGGGCTCCC CAACTATAAC TATTTTTCAT ATGCCCACCA TACCGCACTC ATTATATAAG CCTTCCACAT GGCATTGCAT AATGACGCAG TACCAAAAAT TTCTCTCGAA ACTCCAACCC CCCCTCCTGT CTTTGTTGCC TCAAATTAAG TTTTAAGCAT CGTCGAGCGG GACGATGACG CTCTCTGCGA GCTGTCAGGC GTCGCTCGTT AGTACGTGTC AGTGGCGTAG GCCCCACCGC CTGCCACCAC CTCGCCACTC ACCACTAGTC AGCTCCTTTT TCCCAATTTC GGAGAGTCTG CCCCTGCCAC TGCGACCCCG CGTTGCCCCA AGTCACGTCC TTTTGTTGCA GGCCAAAGTC TTTGCCACTG CAGCAATTGC TGGAAAGACA GGCCAGAGGG AGGGGGGTTT CTTGTCTTAA GATTTCGAGT TTTTCTTCTT TTTCTTCCAG CTTTATTTCA TTATATTTCA TTAGAAAAAC ACCTCTTTCA AATACTTTGC TATTCATTTT AAAAATATAA TTAGTTTGTC TTTATAAAAA ACAGCTTGTA AACTTTTTAA AGTTTACCTA AATTGTTTGC CGACAGCAGA AGTGCAAGAA TATCAATTTT TCAACGAAAG CGCTCTTTCT AGCCACGTTT GCCTTACCTT AACAACGTTT CATTTCATTT GTTTTTGGCC AACATGCTGC TGCTGCTATT GTTTCCGCTT TGAAACAAAC AACGGACACA AAGAGCTCGA ATTCTATTAG CCAAAAGTCC GTGTTGCAAT TTTCTCCGAT ACGTTCCGCT CAAGTGCCTG ACTGACTGAA GATTCAAGTG CACGTGCTGG CCCAGAACCA AAGAAAGATT GCCCGGAGAG AATAGTAGAC AACTAAAGAA TACGATCTGC AATTTAAATT CTAAACAAAT TGACTACATA GAAATTCCTA TTAAATGAAC TAGATCTATA TGCTCATTAG GTGAGATAAT CGATATCGTA TTCCCCCGCC TGAAGACACC AACTGGCCTC GTTTAATTGT TATAGATCGT CGTCGAGTGA GTGGAGCTTC TCATTCACTT CCCGTATCGA ATTTCAGCCA CATCTCTAGT TTCAATGGAT AGCGGAGAAC AAGGTTGTCA TGTCACTGGG TCCGTTGCTT AACTCCATCG CCAGTCGATG TCATTATTGG CTCATTATAA TTATCAGGTT GCAATTTCTG GCCGCCGCTC TCTAGACAAT TCATTCCGCT CTAAATTATT TGTGCAACAC TCGGCGGTGG CAGTGGCAGT AGCATTCGCC AACTGTAAAT TGCTGCCACA ATAATCGCAA TAATTAAAAG CGAGCCCGGC CACAAATCAT GGAAACTGCC GGCCGGCCGG CAGACGCAGC GTGAAAAGCG GCAGCGGAAA AGCGCTCGGT AATTGAGGAA AAATCTAGAA CAATCTTGGG TTGTATGGTC AGGGATGTGG CAGTGACTGT CGGATCACTG GGATCGTGGG GCGTTTTGTG AAAGGGTTCT TGATAACTCA TGGCAATTAA AAAATAAAGT GAGCTGACAT GTGGCTGCAG CTATCTTTCG ATGCCACTTT TGGCTGTGGA TTATGTCGAT TATTGCGGAT GTGGCAG