Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000105
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200325
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200105
Nearest Genes
Gene Nr FlyBase ID Distance
CG3696 FBgn0086902 19233 bp
Sequence Length 2199
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGGCGAATGGGGAGTTCGCTAC
Right Primer TGTTGCCATGCAAATGTATGCCTTTTAC
Template genomic
Sequence GGGCGAATGG GGAGTTCGCT ACATATGATC GTATCGTTCG ATGAGTACAT TCGATAACAT TCAAATGTGT TTGGTGGATT GGGGAAGTTG AGAGATGCGC GAAAAAAGAA ATGCGTTGTT TAGTAAAAAT TCAATTTTCT CGGTTCAACA ATTTTTTGTA TGATGTTAAA TAAAACAAAA ATCAAAAATG AGACCATAAA GGGAAATAAA GTAAAAATTG TAACATTGTT AATTGCCAAT TTGTACTACA GATTTACCAC TACAAAATGC AGAATCATAC AAAGCAAAAT TTAAAAGGTT AGTTGAGCCT CTTGATGGCT TTTTTTTTTT GAATTTGGTA TTCGTATTAA AAAATATAAA TTAATTATTG AATTGCATGT ATAACTTGGC GGTTTTTGTA TTATGAGGAC GACTGCACGT ATGGAGGTTA ATAAAGATGT TGAGTAGCGT GAATTTCCCT ATTCGCCAGC TTTTTTCTTA AAAGTGGAAA ACACCGTGCG TGCAAGCGAG GGCGACGAGC GATGGCGATC GATATCGGTG GTTGAGGAAT ATATGGGGAT ATTACCTTTC CAAATTCAGA TTCAGTGCCA ACTGCTGCTT GGCCCTCGTA CTGCTGCAGT TTTTGGTGGT TATATAATAT ACGTATAGAT ATCGCAATGA GGTCAATTAG GAATTTTTAA GGTTTGTTAA ACGAATCGAA AAGATACAAA ACACAGCGAT AGAAGAAGAT TCGATACGCC GAAGATTAGT TGGCAAAATA TAGAATTTAA ATGTTGTGGT TACAAATGAG CAGAATCGTG TATAAGATGT ACAAGTGTTA GCATTTTAAT GGACAAGCAA TCGAAAATAC AAAGAGAGTT GCAGTATAGA GATACATAGC GAATAAAAGA GAATCACATT CCACCTGAAC CTTGAAACGC CCACTGATCA TTGCTTCAAT CAGCAGACAC AAAGTTCTAT AAAAAAAAGG GTTAATAATA ATTAAAAAAA AAGACACAAA TTGGCATTAG TAAAGAGGCT ATAAAGTATC TATAACAGAA GGTTAAATTA AATACAAAAT TAATGAAAAC TCTTTGATAA TCAGCCAGTC AATCATTCAA TCAACAACAA CAACAAACAA AATGATTAAT GAATGCCAAG TGTTTAGCAG ATGACTCCGA GTGCCACGCC TACCTGATAG GCGTGTTGTC CTTTATCTGC TGAACAAAGT CGCCAATAAC CTCATGTTGA ATATAATAGA GCATCCTCAC GCGCAGCAAA ACCCTGTAAA TGTTTACATT AAATAAACAA AATGTATGAA AATAAAGGGA AAAGAGAGCG AAAAAAATTG TTAGCAACAG TCCATCTCAA ATTTGGAAAT ATCTTATAAC GAGTTCGATT CCACACGACT CACTTATTGG CGTGTCTGCC TAAATGCTTC TTGTAGGCGC CTTCCAAGTA CGCATCAGCG TCGTACTTCT CCTTCTTGCT CCAGTGATTT GGATCGTGAA TGCTTGTGAC CGCCGCGGCT ACTGCGCTGG CATTTATGCC GCCGCTGTCC TTATCGGACC CATCCAGCGC ACTAGATTTG TGAGCCGGAG TCGTGTTTCC ACTATTGCTT CCGGATGCAG AGCCCGGAGC AGGAGTAGAC ACTCCTGTGG ATTCTTTGTT TGACTTTCCA CCGTTGCGAC CTGTAAAGCA AAAGTAGTGT TTACACAAAC ATTAGTATAT TCATATTTCT CTAGCTGCCT TCAGACTGAT ATATACACTA ATCTGAAGGA CAACAAAGCT CTAGGTATCA AAATGTAAAA TCAAAATGAA TTTACAGCAC CACCGGATCT CTGATCGTTT TCGTTTAAAA GAGGTGTTTT TGAAGGGTAC TTAATATAAT TGGCTATAAT TTAAAATATT GCCTATACAT GAAAATGATA CACAAGGGAT ATATGATTTT AAAAATTAAA TACATATTAA AAATTAAATA GTTTAAAATT TCGAGATATT ATGTATCTTT CCTACAATGT TACCTTTTAA GCTAGCACAT TGTTCGACTC AACAACAGCA AATAAAAAAT AAATTAGTAG TAAATTAGAA AATGGTTTAG GCTACTCTAT ATAAAGAGTT AATATGAATT TTAAAGGGTA TGTAAGTAAA ATGTTATTTA TTATGTACAT AAAAGTAACA GATTTGATAT AGTAAAAGGC ATACATTTGC ATGGCAACA