Vienna Tile Information
VT ID VT064565
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200324
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 264565
Nearest Genes
Gene Nr FlyBase ID Distance
CG33517 FBgn0053517 10313 bp
Sequence Length 2078
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GGCGTCGGCACCCAAAAACTTC
Right Primer GCGAGTGGCATAAAACCAAAGACCA
Template genomic
Sequence GGCGTCGGCA CCCAAAAACT TCTCTCTCCC GAAAAGAGGA TGCCCCATGA AACATGGGCG CCAGGTAGTC AGGGACAACA TGAAAGTGTC ATTGAGCCCC ACTTTGGGAA CTTTGTCATT TAAGACGCAG AGTCTAACGC TGCTGTGTCC TGGAGATTTC TTTCGTCTAA AAATACTGAT GTTTTTAATA TTTTTAGAAT CAAAACTAAG GCATAGTATC CAAGCCCGCA TACTTAAGCA GAAAACTTCT TACAGAGTTT TGACCACTTA AATACTTTAA TGTAGATTTA ATGCATTTTT GGAGCATGGT TATTACTTGT AATTATTGGG CTTGAACGCA ATTCTATTGT GCTGAGATAC TCGAGTTCAT ATATTATACA TACATAAAGA AGAATTACAA TTTGATCATC TTTCAATGAG GACATCCTCA AGCACTACGC AGTAAAATAT TAATAAATAT CAATATCATA AACAAAAAAA AAAACGATGT TTAGGTACGT ACACACAAAT GGCGGATTTC GACCGATTCA GTTGAACTTT TTTCGAGAAC TCGACAAATT GTGGCCCGAT TAAGTGGTGT GTCCAATCCT CGGTCATCCT TTCCCATTGG CAAGTCAATT AGAGGCCCTT GACTTGCCAT CTCCGCCCCC CAGCTAAGCG GACTTTCAGC TGAAGGGTTT CAGGACTACG ATTTCAAAGG GGGCAGGGTC TTTGCGAATG GGCGGGGAGC TGCAGGTTTT GGCCTATGCC AAACGAACGC GTGCCAGCCA TTAAAAGCTT TTTAAAATTA ATTATAAAAC CGAAAGTAGA CACAGAGAAA ACTCGCCCAA ATAAAACGAA CGGAACGAAA CGTAACGGAA CCTGACAACC CTTTTCTCCG TTCTCCGTTT GCAAAATGGC AGGACGAGAA CGGGCAGATC CTGTCCGTTC TGCTTCTTGC CAGCGTTTTT TTGTTTACCC TGGGAAATTC AACTTCAAAC AGATTTTTGA TACTTCACTG GGCAACCGCA GTGTGGGCGG TGGGTGGTGT ATGGCAGGTG GCCTGTTGGG AGTAGGAGTA GAAGTGGGCG TGGCAGGCAG AGCATGCGTA ACAAATTGTG CACATTATGT GGCACAGGAA ATAGTTGCCA ATGAGCCCCC AAGTTAAGTG TCAAGCTGAG AGGGAAAGTT TTCCTGATTT GGGTTCGCCA TTTGAGCCCG TCCATCGCAT CCCTGCATTT TGGCCATTGG CTAAGCCCGC TTTCGGCCGG ACAGCTTCAT TATCGTCTCA TTAGAGCCGA AAAATGCTTC TCAGCTTCTC ACTACCAAAT TCAGTTAAAT TCGGTATCCA CGTAATTTGA TTAACAAACT TCGCGTGCAC TGGCACACGT TGAACTTGAA ACTTTAAAGG TTAGCAATAA AATCAAAATG TCAAATTTGG TCCGAAATAT CAAATAATTC GCATAGTTGT TGGCATAGTT TAATGCTCAA TATTGCATAA TATTAATTAT ATTCGAGATG CAGTACGTGT GTTTAGTTAC CTAAAACATG TGATACTCAC TGAACCCTGA TTATGTTGGC TCGTTTAAGA ACGAGAGCAA CTCAATACAA ACAAATTAAA TCGCAATGAA AGTTCCTTCT TCTCCTGGGT ATTAAACCGT GTGGTATCTT CTGGTTGAGC CAACTCTTTT CGCACTAATC GAGCCATCGC CGCATCCATC CTGTGAAACA GGCTTTTCTT TTTCCTGTCA AAAGTAGTTG TCGTTGTGGG GAAAGAGATG ATAAATGATG CAGCGGCAAC GAGTTTGGTT GCGGAGCGAT AAACTAGAGA AAAAGCTGGA CAAAAGCGGC AGCTCGAATT GCCAAGGCTC CTGTGCCCGT GTGTGTGTGT GTGTGTGTGG TAGCATCTAT CTCTGTCTGG CAGGATGCCA TAACATTTGG CTTTTTACGA ATTTTCATAA TTTGGCGACT GCTTAGCATA AAAATGTCAC AGCAGCTGCA AAATATGCTG CTAAGGATTG GCCGTCGTTT CCTTCTCGCT GATCCTGCTC CTTACTGTTT ATATCCTTAT TCGTGGTCTT TGGTTTTATG CCACTCGC