Vienna Tile Information
VT ID VT040973
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200273
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 240973
Nearest Genes
Gene Nr FlyBase ID Distance
CG8795 FBgn0038139 1059 bp
Sequence Length 2162
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGTTTTTCATCTACAGCAGGCATTTCACA
Right Primer AGAGCAGAACAGCAGCAGCCGAA
Template genomic
Sequence CGTTTTTCAT CTACAGCAGG CATTTCACAA AAATAATATA TATGTGTATT CGCATGCGAT ACGATATGGT TTTGGCTTAC AGCCACAGCC GGAAGGCAAT GGCTGTAAAT TTGATTGCCT AAACTGAGTC GAACCTCGTA AGGGATTGTC GCTGTTTTTA TCATGCTCTT AAATTTTTTG TAATTCACAA AGGCTCTCTA TTCGAACTTT CTATACGGAA AACACATAAT GAATCAAAGG ATCAAAGGAC CGGTTCTACG AATCAATTAA CCAGGTAACT CATAACTGGG GGACATACGA TTAAGGGTCT CGCATCAATC ATACGCACCG TGCACGATGT TCCCATGCCC TGCATCACCA CGGAGAACTG AATGGCTTGG GGCAGGGCCA GCAAAAGGGC AGCTATCCAG ATGGCAAATA TGAACTTTAC GGCCCGTGAC AACTTGGACA TCGTGTGCTG CCTGTATCGA AAGCAGAACC AATTAAGCAA GTTTGGGGCA AAATGGAAAT GGGCAGTGGA AGGAATGAAG GTTCCCTTAC CTGAACGGAT GACAAATGGC AATATATCGT TCGACTGTGA ACGCGGTAAT GGTTAGAACT GTCGCATTGG CCGCCGTTTC CGAGAGAACG CTCTCCAATA TGCAGATGCT GTCACTGAAA GGATAATTAT CCGGGTGCCA GAGGTTATAG AGGTCCTGCG GCATTCCTAA GAACATAAAT AGCAAAATAG CAAAATATAT AGTGTGATTA TAAATATTTA ATAATAGCTG AAATTATAGC CTATAGCCTC AAAATGCAAA TCGATTTGAG CATCTGCCGA ATATCTCACT CTACATTTTC TTGTTTATTT ACAAATTTTA ATTTAATATG CCTCAGTTCC ATTTATTGTT TGCACTACTG AACTGAATTA AATTATAATT CAAAAACCAT GAACATTTTA GTTTTGCACT CACCTGAGCA TAACAAAATC ATGTCGGATA TAGCGAGGTT AAACAGATAA AAGTTGGTGG CCGTGTGCAT AAAGTTGTTC CGCGAAATGA CAATGCATGT GATGAGGTTG CCCAAAACGC CGGCGATAAA TATGAGGGCG TAGCCCACGC TTAGGGTGGC CAGCAGTGAA AGTGGTGTCA TCGGGGTCAC CGTGGGCAAA AGCTCCTCCG GCTCCAGGCC CTGGAGAAGG CTGGTCAGGT TGTCCGCGGA GATGTTCAGC ACTTGTGTCA GATTTAAGAG AAATTTCTCA TTGTGAAACA GTTGTAGATC GGTTGCCAGG ACACCGGAAC TGTTAGTGGG CAGCATTTTG ACTGCCATAG GGTGTGTGTC TTTGTGTGTG TGTATACGCA CTATTATTTT CGAATTTCTT TGGAAATTTC AGACTTCTGC GTATGTATTC TCAATCGAAG CTTTCGCTTG CAAATAATGT TTTCATAACG CCCCTTACGG GGGCTCATCA ATTTCGACTT AGGCCAGAGC CACTCCACTT GCAATCTGTT GTCATGAGTG TGGGATTAAA TTATGTGTAC GGATGTGTGT GATAAGGTGG ACCCTATGTG CTATTTAAAT AAAACTATGT TTTTCAAAAT TTGTTAAAAT TTAAATAAAA TAATACAAGA CAAATAACGC ATTTTAACGA ATTTAGTAAT AAAACAAATT CAAACATTAA GGCTTTTTAC TCCAGATTTC TAAATTACCA TAAATTATAC ATATACACAA TTTGGTTGGT AAGCTGTGCG CTTTGTTTAG CTTGCTAAGG TCCACCTTAG AGAGCCCGTC TTAAAGCGTG TTTGTGTCCT GTGTGTTTAC CTGGCATCCT GGGAAACTGG CAGGCGGCAG TCAGGCGTGT CCTAGGCGAA AGACCAGGAT CAGGGCGAGT GGAAGCTGAA AATTAATTTG AATTGCTAAG TGGCATTTAG TCAAAATATT TGTGTACACT GGATGAATTT AAGGATGTTG CTACAAGGCT GAGAAGGACA GGCCTGCCGA TCCGTCTCCC ACCCAACACC AGGTGGCAAA CGAATGAAAC GAGCCAGAAG CTCAAGGTCA GGTGGTGGAT AAGACGGATA AGGAGACGAC GATGGCAAAT GGACACCGGG TGACTTAATA ACATTAACAT AGTTTCATTC CATTCAGATG ATGAGTGTTT TCGGCTGCTG CTGTTCTGCT CT