Note: this item is temporarily unavailable.
 
Vienna Tile Information
VT ID VT033008
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200242
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 233008
Nearest Genes
Gene Nr FlyBase ID Distance
CG3979 FBgn0036816 12357 bp
Sequence Length 2127
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GTGCGTGTTTCGCAATTTGGTTTGT
Right Primer CTTCGCGAACCGAGCGGAAGC
Template genomic
Sequence GTGCGTGTTT CGCAATTTGG TTTGTACTAT TCACAATCTA ATCATATTCT AACATCTAAC AATAGGATCA CACTGAATTC ACCAAATTTT TGTAGTGTCC TTAGTTTTCT AAACTTGTTA TTTAACAAAA TCTATAACAA TAGTCCAGCT GTATCTCATG TCCCAACTTT GGTTTCCTTT TGTTTACCTG ATCACAATCT AATTAGCCAA CAATGAATCT CGAACCGCAA CTGTCGGAAT TAAACTTGAA CCAAAAGTTG GGAGAGCAGG AAGGTAAACA GGATTTTTCC GAGCAAATCA ATTAGAGCAT TTCCCCAAAA AAGTTGCAGG TTAAATTGTT GAAATGCCAG AGCTTGCCGG GATCCATCAA GGAATCCCTT CCAGCCTCTT GGCGCAACCA TTACAAATGG CTGCGACTTG GCTGGCTGTC AGTTTGGGTT CAGTTCGTGT TGTGTGTTCT GTTGCGCTGT GACTTTTTAA CCTAATGAAT AATAAATTGG CCCAATTGTC ACGCAAAAAC AATGCCGCGG AATAGATGGA TAAGGGTTTG CACTGCGACC TGACATCAGG AGGTCTGCGA AGTTTACTTC TCCAAATTTT AGACACATTT TCCATGCCTG CCTTTCCATT CCAATCCATT GCCGCCTGCC TTTTCTTTGC TGTTTATTTC CGCTGAAGTG TCGCCTTCGA TAGATTTTGG CATTTGTTAC GGAACTTGCA TCCACCTGGG AAATCGGTGG CAGGCATCTA GCAATGATTA GCACTTGCTC TACCTTTTCC TTTCGGCTTA AGTGGCGCCC ACTTGCATTC GTTTGGCCCT TTCGCTGCCT TCCCGGCCAA GTCGAAAAGT AATTAGCATA TTGAAATGTT GCACAGGCCT CGCCTGCGGA ACAATCTCAT AAATAATTTA GCCAGCATAT TTGATGCGCT TCGGTTGCAA TGACTGCATT TCCCCAGTTC TTTGCGATTG CTGCAATGTT ACATGTTGCC CGTGTGCTGG CTTCAATATT TAATTGCGAA AAATCTCCCA GCCGCGAAAG GGGCTATTCC TCGGCTACTT CATCCTTAGA CCTCTTAAAA GCGTGTCAAC AGCTTGTCAA TCACAATTTC GCAAATAAAA TGTAAGTGTC AGCTCATGGA AATTTAGTTT GCGAATGTGT TGATTGTGTT TTAGTTGTGG CTGTTTAGAA ATAATTGGGG AGCGGTGGGG CTAAAAACAA ACTGATGTGG GGTATTCTCT AAGGCATTGC GTGTTCCAAG TACAATTGCC ATACAAAAGG TTCACGAAAT CAAAATAGTT TCATCATACC TACACAATAA TAAAATTCCA AAAGTATCTT AAGCTGAAGT GAAAGAAATA ATTTTACATA AATCTTGATA AATTCAAAAG TTAGCATCCA TCATAAAAAA ACGCATGCAA TTCACACCAA TTAGAATACT AAAATTTCAT TAGTTTCAAA TTTAAAAATT TGATATGCAT CAGTATATAG GAAAGAATAG CTATTCTATC CAACTGATAT ATGTATATAT GCGAGAGTCA CTAAAGTTAT TACATCATAA ACCAACGAAT ATAGTTACAT TCCTAAAAAA GCAAATTTGA AATAAAATTG AAATACAAAA AAACATTTAA CTTCGGATGC TTTTCAATTT ATAGAATTAT TTTACCCATA CCAATCGTTT ATATTTATTC TATCTATTTC CAACTGACTA ACTAATTTTA TGCGGAGAAT AGTTAAACCT TTTAAGAACT TCCAAACTGA AACATACAAT ATCGGTCAAA TGCCATTAAA AGAACTAAAT GAAAACCATT TAAGCAATTA AAAACTGCTT AAATTAGCCA AGAATAAATT GAAACAATCT GTATCTCCAT AAGCGAAACG AAATAAACTA AAAAGTAAAA TTCAAAATTT GACATAATTT ACGCCTGCGC AACAAGGAAT AGTGTAGGTC CTCGGCAATA AAAAACCAAT GCCAGGACTC TCATTGGTCG CCATCGAAAA GGCAGCCGAG CGAAAGCCGA GCTGCGGTCG TTTGCATAAC ACGCATACGC CGCATAGGCC CAAAGGATAA AAGCCGCCGA CAACGAGGGA TGTTGCTTCC TTGTTGGCTT CCGCTCGGTT CGCGAAG