Vienna Tile Information
VT ID VT032776
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200240
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 232776
Nearest Genes
Gene Nr FlyBase ID Distance
CG4319 FBgn0011706 7068 bp
CG13701 FBgn0036786 32333 bp
Sequence Length 2136
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCCACAATTTGATGATTGTCCTAAGACTTTTT
Right Primer CGGGACTCTGGCAAAGCAAACAAA
Template genomic
Sequence TCCACAATTT GATGATTGTC CTAAGACTTT TTGCTGCGCA CGATATTAAA AATGCCCAAC GCCCTTTTTG GCCTATAAAT TGTGCGTGGT AATTAAGTCC CGCCCAGGCG ATAAAAGTCC AGCGTGTTGA CTAATAAAGC CCCAAGAGCC TTCTTTCTGC CTTTCGGATG TCCCTTGAGA TGCCCCCCCG ACAATAATAA CTCATACGGC CATTTAAGTG CCGCCCAGGC TAATGACCAG ATACTCTGCT ATCCGCACAA ATTGCGCGCA ATTAGTGTGC AATTTTTGAG CGCTAGGTGG CGCGCATCTG CGCCAGCTGC CACGCCCCTC CCACCGCCCA CTCGCATGAT TAGTACGGTG TGTGTGTGTG TGTGTTTTTG GCGTTGTAAT TGCTTTTTGT AATGTATGCC CTCGACTCCG CTGTCGATTC AATAGCCGTA GTCCTGTGTT CTTTCCGGGC CTCCTCCTGC CAATGGACTC ACGAGAGTTG TCAGCTTTTG TTTTGCTCGC CATGTGCGCG AGCAAGTGAT ATATTTTGAT ACCCCGTGAT GGTAGGGTAT ATCCCTACAT TTGGGAGAAC AAAAAACCTT AAAGCCTAAA TATTTTCTTA TAAGGTATAT TAGCAATCGG AAAGTTTGCG TTAGATGAAA TTCCAAAGCT TAAGGAATAT CTTATGTAGC ATCAAAGATA CATTTTATAT ATATATAAGT TATATCTAAC TGCGTTGTTT GAGTATATTT GAAATGTTAT ACGAATAGTA TAGGGTATGA GCTGGGTGAT TTGTGGTTGA AAGGTTAATG ATACCTCCTT TTTTCCAACA TGTCGCAACT ACCCACAAAT GTCGCTGCCT CTGCCGCTGA TGATGCACTT TGGTCCATCA TTATGACAGC TGCTTGACGA CCAAAGGGTC GACTTCGTCA TCATTGCTCC TGCTCAAATT GTTGGTTTTG TTGGGATGGA TGAGTTTTGC CCGCTGATTG GGTACATTTT TCTTAACCGG CTGGGGCTAA TTTTTTTTCG CGAAAGGAAT GCGCTTTGTG ACATTTGACA TGTGTAAGTA CCGACTGAAA TCGCAGCGCA GCTGATGCTT TCCTATTTTC CATGATTTCC AGCAGGATGA GGCTGCTTCG TCATGGTTAT TAGTCCTCAC CATTTGTTGT GTTTCAAGGT TTTAAATTAT AATAATTAAT TTTGCAGCTA ATAATCGAAT TAAATAAATA CTTACTGTGC TCTTCTGACT AAACATTTGT ACAACTTATA CTTAGTACTC TTATTTTCAG ATTTGCTTTA AAAAGCTGCC AATCAGATGC TACTTTTGCT GTATATGTAT TTCAATAACC TGTGCGTTTT GTGAAAAGAA TCCGAAATCA ACGTCCGTCC ACCTCGTTGG TTGTAATTGC CGTAGTCCTC TCGCTGGCCA GATTCATCCA TGCACAAATT GTTCAAAGTG AAATTCGCTG ACTGCTGCAT TTGTCAGTTT GTCCTTTGCC TATTTCAGGA TGGATTTTTC CGATACCCTT GGAACGGGTA TTAAAATTTC CAAAATAATT AAAAAAATAT ATATTAATTA TTGCTTAGTA AGGAAAGTAA GTAATCTGTT TAAGTACTAT AAATTCATTT AATCACAAGT CTTAATTGTG TGTATTCCCC ATATCGTTGA AAACGTGTTG CAGAAGTTAC CTTTTTAAAC AGGGTAACTT AATTTGTTTA CTTATTTTTA AAGTATTAAT TTTTAGCAGA AAATATTTTA TGTACATGTA TACATTTTTA CTTATTACCC ATTTAGCGTA TTCGATAGTC ACCGCATTTT TGAGCTTATT TAAAACTTCT GTTGCAAATG CGCTTTTACG CTTCTGACTT CAATTTGCCC AGATCCGCAG TTTTTTTTTT TTTTTTTTGA TATTTCACTT TGCAAAAATA TATCTACATA TGTATACACA CAGTGTTCAA CATTTGCGGC TCTTGTTGTG CGGCGTGTGT GTTTTTTTTT TTTTGTAATC GCATTAAGTG CGCTTATTTA ACGCAAATCT GCCCGAGTTG AGCGTAGAGT CGCCGGCCTG GAATCCTCGA ATCCTCGAGC CTTGATCCTG GCCAAACGCT AATGATGACT AATTTGTTTG CTTTGCCAGA GTCCCG