Vienna Tile Information
VT ID VT019074
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200220
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219074
Nearest Genes
Gene Nr FlyBase ID Distance
CG16720 FBgn0004168 42265 bp
Sequence Length 2160
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TGGCCATTGCAATTATCCTCTCGAT
Right Primer TGCTTTTCACTCATGCGAACTCAAGG
Template genomic
Sequence TGGCCATTGC AATTATCCTC TCGATGGAAG CAAACCGCGC CCATTTAGGC CACAATTTCG ACAAACCCAA AGGGGTCAGT CAAAGGCCAA ACCGCAGGCA GCATTCCGAA ATTTCTGTGC ACATGTCTTG GGGCATGACC CTATGAAATT ATGCTGTCCA ATTCAAATAT GCATAGCATA CTGCGGCGAA ACCCCAAGGA AATGGGGGCT GTAATTAGGC AGGAATCATC CCGAGTTATG AAATATGCAT TGCAAAGGTT TTTTTTCTAT GCTCAGTGGG TAGGAAAAGC TAAGAAATCA GGGGAAGGCA GGGCTTAAGT TAAGCATACG CCACGTGGAC ATTAAAGCCT TCTTGGCCGA AAGTTGAGCG ATAAGTGGCA TCTTGTCCTG ACTGGCGAAT GTGTGAGAGT GGTTTGGCCA GAACTTTCTA CCCTAATGCG CCAGCTGGTC AAACTAATAC GCACAGGATG TGCTCAAGTC CAGTCTGGCC AAATTGTAAT TTTGTTTTCG CTTCGAGAAG AAAGAATTTT CAACAAGTTC CGAGTTGCTT ATCAACGAAA TTAAAAACTA ATTTTCGTTG CAAAGAATCT TCCGCTTGAC TTTGCTTAAC TTTTAACGCA CGATAGTGTA TCTAGAGTTT GGTCTTCACT TTTTTGCCCT CTAACTGACT TTTTCGCCAG GACATTTTAT TTATTTTTTT CTTCAATCTT GACCTGCTGG CAAGCTGCTA CTTAGCTTAA GCTTAGTGCT TACTAAATTG AAAATGACCA TTTGACGTAA AAATGTTTGC AACCACTTAC AAACACATGC GCTTTTACAT ACAGCTGCGG TCATAGAAAT AGTAGCTAGT ATCTAGCCTA TTCAATGGAA CTGAGCCTTC ATATGCCTAT AACTCTGAGG ACTTGACTTA CACAATGGAA TGGTATCTTT TAAACATATG ATTCTGCATT ACACATTGAT TACAATTGTA TGTATGTAAA ACGCTGATTA GGTGAAATAA GCAGGCACCT TTCTCACTAT TATTTTGACC GCATCTGTGC GAAGCCACGT GTGTGCATAT CACACTGACT AGAGCGAAAA GTCATTGGAA TCACAAATTC AATGCGCAAA CAAGGCAAGT TGTCCACTAT TTGCCATCCG TACACATGTC CTGCCCGACG TCCTGCCCCC CGATGTTCTG CTCAGCCAGC TATATATGCC TGCTCCCATG TCCTCCGATG ATGTCCGGCC CAATCTAGCT GGCCTCACAT GCGTGCTTTA GTTACATGTC AACACACTTA CCCGCACACC CACAGTACAC ACAGCACCGT GGACAGGACA CACACCCACA TCCATTTAGT GCCACTCACT AGTCGGTCCT GGTTCGGGTT CGGTTCCCAC AGAGCAGCTT GTTGATTTTA GAATATATTT ACCCGGCACA CACACACACA CACATCTGAT ATATCCCTTA CACCCGTTGT GTTGACCATG CGATCGAATT GAAAAGATTT CCCGGCACTC TCGGAAGTTT GGAGGCGCAG GAAAGGGCAT TAGACCTGCG ACTTGTTGTT TATTGGTCTT ATTTGTCCGT TCTTTAATAA CTAAATGCTT TCAAATCGCA AATTGCTTTT CTCCACGTTG ACAAGGGTAT ACCAAAAATC GCTGCGTTCA TTTTGTCGAC CATTTTTGTG GGTAAAAAGG GTATTGGCCA GTATAAATTT CAATCTAATT GCCTTTGCAT TCGGTATGTT TATTGGCAAA TTGTTAAATA ATTCGATGGC ACAAAGCTGC CTAATCGAAT TCACATATGT ATATGTAACA ATCATTGGAC AAAACTAATT TTTCGCCAAA ACACGATGTT TGTATTTTTA ATTAAAATGT AATTTTCATG CCGGTCACAC GCACATTGAT TTTCCAATTA ACTGATGGCC AAACAGCAAT TAAGCCAAAC AGGTATTATC CTTAATTTAG CTATTGGCAT TATGTTCGGT CCAACGGCCG GCAAATGCTA TTTATAATCC AGCAAAACGA AGTGAACCAA ATGCCCCAGG GCAATATACC ATCATTACAA TCACATTTGC AAGAACATCT CGAATTGATT GCTCCAGATA TTGACACTAT TTTCATAGCC AAACATGTGA CAGAACAGTC GAGGCCTTGA GTTCGCATGA GTGAAAAGCA