Vienna Tile Information
VT ID VT019023
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200219
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219023
Nearest Genes
Gene Nr FlyBase ID Distance
CG15105 FBgn0034412 28397 bp
Sequence Length 2199
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CGATTTCTGAGTGGGATTTGGTTGCC
Right Primer GACACAATTTTCTACTTTTTATACACCTTCGTTTCA
Template genomic
Sequence CGATTTCTGA GTGGGATTTG GTTGCCACTC TGCGCTTTTT AAGCATGTGT GAGTTCGGGG GTTGGGCCAA GCTCAGCCCT TCAAGTTTGG TCAACATGTG CCAGATTCTT CCACTCACTG CCTTCCATTT AAAGCTATCG CGACTATACT AGTCTTGGCA GCGAAAACTG TTTACTTGTT ACTCTTGTTA GCCGACTACG TTGGCCATTA GTCACTTCAT TAACATGGCA AGCAGTCGCT GAATGAAGAG ATAAATGCAG CGAGCAGCCC AGGAACGTGC CAAAAATTAA CAAAACCCAG AAAATTGACA AAACACAAGA GCAAGCGGAA CAAAAATAAA CACAGCTACA CGTTAAGAAA TGCATAATGT ATTTAGCTTC AGGAATAAAT GCAATAGGTA ACGATAAATA TTTAACTCAC AGTTTTGTTC TACTAAATAT CCAATAATAA CTTTATTTCA AGGTAACAAA AATATAAATA GATCCGTGCA TTTTTTTTTT GTGTGCACCC ATTCAAGAGA ACTATTGTGC CCAGAAGGTT TAGCACGCGC TGAATTTTAA TTTCACACTT TCGCACTGCA ATCAAAGGGA ATTAGCCGCC ATACAGCTGG CGCCCAAAAA ACACAGCAAA CCACTCACAG CGCACACCAC CCATCGCCCA CCACCGCCCA CTGCTTTCGA GTGGGCGGTA GGTGTCAACT TTGCCTTGCA TGCCATGGAC GGTCTGCCAC GCCCACTGGA AAGGAGGCGC TCGTGCTGGC ACTGCTGTTG ACTGTTATTA GCGCACTTTG ATTTGTATTT GGCTAACAAT AAAATGACAG CTTGCGGCTA AATGGCACGC AACGCCCAGC CAGAAAATCG AAAATGGTAT GGGAAAATGG GTGGGTCCCG CTTTCTGGAC ACAACCTGGC CGGAAATGCC AACGAAGTTT TGGAGTTAGC TGGCGTGCGC CTGCCTTTGG TTTACTTTTC ATTCCATTCC GATTGCCCTG GCCAGAGGCA AAAGTCAGCT AACAAGTCTC CGCTGCACGC CATAAATTGC AATAAACGAG CGCAGGTGCA TTGCATTGGC TAACTGGCTG GTTGCGGTGG AGCAGAAATA TGATAACCGC TAATTAACGT CAAACGGATG TGGATGCGAA AAGTCATGCC AAGAAAATAT GAAACTTGTG TTCTTTAATA ATGAACAAGA AAGTCTAAAC TAAATTGAAT GGTCGTGTTA AAACATACAT ATTTGAAGAA CGTATTTTTT TAAATTTAAT TGAACTGAAA ACGTAAGATT ATCTACTTGT GTCTTAATCA AACATAAAGC ATAGTATTAT TATATCAAAT CTTATTGTTT ATAAGTTTTT CAACCTAGGC AAATTAATCT AGTCAGATTC TTGATTCTGT TTACTTGCAG TGTACATAAG AAGATAAATG AGCAAGGGAA GTTAATGGGA AAAGAGTTCA TTATAATGAG CGAAACTGGT TACAGTCGCT GCCCAAAATG AACGTGACAG TCCGAGTCTA CCGGCAAATG TAACCCCAGA GTTTCCATCA CCCCACTTGG CTGATAAGAT TGGAAAAACT CTACAGTCCA CGCTGCGTAT ACGTGATACG GGTATAAGAG CTCGCGTATA AGAGAGATAG GACCACACAT TTCAATCTCT ATGGAGTAAA CAGAAAAAAC AGCCATTTGG CTAAAACGCA TTGAGTACTC CTCTGCGTGT AGACTTTTAA AGGTAAAAAG GCGAATCGAG GACGAAGCCG AGACAGCCGA TGAATGGCGA AACGAAAGCG AAAACGAATC TGAAACTTAA ACAAACACGC AAGCGGCACA CAACAAAGGC AGAGAGGTGC GAAAAAGGCG TGGTATGATG TCGGTGGCGG CCCAGAGACA TGCAAGGACC ACAAGGACTA AACACATTGT ACCACCAGAT AAGTGTTCTA GCCATTACTT ACCAGATTGC AAGGAGTGGC ATTGGTGACA TGAATTTTGA TTTCTAGGTG TCAACGCTGA TTCGAAAATG AATTATTGCG ATAAATGATA AACGAGTTAG GAATAATTTT TGGTAATTTT GAAAAAATTT GAACTAGCTT TGAAATAGGA TATGAAATAT ATGATAGGAA TATACATTTT ATTTGCAATT GCGACTTAAT ATTTATAATA TAACTTTCTA TAATGAAACG AAGGTGTATA AAAAGTAGAA AATTGTGTC