Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT000132
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200177
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200132
Nearest Genes
Gene Nr FlyBase ID Distance
CG11592 FBgn0025686 0 bp
CG3625 FBgn0031245 118 bp
Sequence Length 2019
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GAGCCCCACCAATGCCCAGA
Right Primer AAACTGAAGACGAGCCTCAATCGCC
Template genomic
Sequence GAGCCCCACC AATGCCCAGA TCAGCCATTG CCAATGCAAA CCCATCGTGG AAACTCAGTG AACTCTAAAC TAAATCTGAA ACGTTCGGAG AATTCCATTC GATGATGTTG CCTCTTATTT GGGGGCGGAT AACAATCAGA ATTGGAACCA ACGAGAGCAA ATAAACACAG GGGTGATGGA CAGCAGATGT AAGGGAAATC AGGCTGATGG GGACAACTCA TACCCTATCA TTTTTGGGAA CATGTTCTTA TGTTACTTAT AGTTACTTTT CAATGTTTAT AAAAATATAA ATGGAGTTTG TATATGTATA TTGTGTTTGT AAATGACATT TGGAAAAGCA TGGAATTCAT GCTTTATATT CTCCACAAAG ATTTTGCTTA TATATATATA TTTTTTTTTT ATTCTAAACA CAGCTAATCC TATTAGTGGA TCGAAACCTA AATCTTTTCT TTAAATATAT TTTACTAATA AATTGTTTCG AATCGAAGAG AATTTGGCAA AAAGCGTACA CAGATAATTT CACGTTTGCT TCAACAATGC AATTGTTTGT CAGAACATAG TTAGTTTATT TGTATTTTGA TTGCGCCGAT ATAAACAATT TCAGCACACC AGATTTTTAA GATGCCCAGA AGACCAGAAG AAAGGTAAAA ATTCGACAAC GAAAATAATG AACCGGATGG TAGTGGCACC GAAAAGTTCT CGTGATCGTT TCAAGGGACT ACATAAAAGA AAAAGATCTG TAGATATAAA GCACTTTATG CTGACCAGAT CAAAGTACTT TTTGCGGGAC AGACGGCGTT AATCAAGGGC GAGCAAGGTC ATGCAATAAC AAACTAAGAT GTTCCTGGAA AGACGCACGG AAATGGAAAG CCGTGGTGTG GAAATATGTA CATATGTAAA AGCATCGTAT CAAAAAAGAG CACAATTCCT TCTCTTGAAT AAATGCAATT AATGCAAAAA TATCTTCATT TCTGGGTCAT ATCTTAAAGA GATTGAGCAG AAATATTGTC AAGTTGAGAA AAATGTATGG AGATAACATC AGAAGTGGAC TCGTTATATA TATGTATGTA TTTTATAGCC CATTTTAAAA CCAGATTTGT GGCAGCATAC ATTTTTCTTC AATTACAAGT ACAATTTCTC TTAAGTGACG TTAATTTCCT TATTTAATAC ATTTTTTCTT TTTTTTTCTG TGGGCCGAAA TTCAAGACAT ATTTATTTAC CCATTCGAAA TGAAATTCGT TCACCAATTC AACAATGAAA CATTCGCTTG TGCCAGTTGC CAAGGAGCTG CGAGAAAAAT GCAATAATCC ATCGATTTTC TAACAATTTA ACGATATGTA AATGAGGCGT CAGAAGCACC GAATAGCAGA ATACCAAATC GAAGCCAACT GCCACGTATG GCACATTTAC ATTGGCGCCC ATCAGATAAT CTCGCATTCG TCAAGAAGTG GAATCAAAAA TCTGGAAAAC CGCGAACATC TGAGCAAATA AACACTTGGG GCGAGAAAAT GCCGAAAAAC GCTTTCCCAC ACGGAATGTG CATTGCCATC AGGGAAAAGT GCAGCGCGAA TGAGGAAATT CGGCGAGCAC AGCTCCCGTA TCTGGCGGAT ACTCCTCCGT ATTCCACAGT TGTTGACCCC GCCTGGCCGA TAAAAAGAGC GTGCAAGTAA GAGAAAATCG AAGGGGAAAG GGGGCGATCC CCAGCGAACA GACAAACAAA TAAACAAACA TATGGCACAC ATAAACCCGA ACATCGGCAT ACGGGCCTAG AATATAAATA ATTTTTCCTT CGCTGATTTT TCTGGTCTCG AGCTCAACAC TTGAAACAAC CGATGCTGGC CGCATTTCCG TCTTGTTTTT TAATTTCCCA TAATTTCTCA CATATGTATC TCTGTATCTT TGTGGCGCTT TCGATGGGCA CGCCGTAAAT TAACTTACCA GCGACCAGTA GGACAGCAAT TTGATTTTCT GGGGCAGCGA TTCGGGAACC AGGCGGCGAT TGAGGCTCGT CTTCAGTTT