Vienna Tile Information
VT ID VT056369
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200168
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 256369
Nearest Genes
Gene Nr FlyBase ID Distance
CG2872 FBgn0028961 17512 bp
Sequence Length 2236
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCAACTGGCTACATTCGCATCTGCTT
Right Primer GCACCACTTTCCCTTCAGTTTTCTTGCT
Template genomic
Sequence GCAACTGGCT ACATTCGCAT CTGCTTAAAG ATCGAAAAGA AACTTCAATT ATGTTTATGA ATATTGAGCA ATTTTTTAAT TGCGGCTTAG GCTGAGACGC AACGCAACGC TTTGGCCTTA ATTTAATACG GCATTTAATA TGATTTTTAA TTTCGCACAC ATTCATGGCA TGGACCAACA CACAAGCAGC TTCAAAGGAG GGCTATGCCC GCTCCACTGC ACCACGCCCA CTTGGTAACT GTTTTAACAT CGGATCGCAT CACTCATACG CAACGTTGAG CACGTTGCTT TTTTTTTTTT TTTTTGTTCA CTGTGCCTGT CTGTTGCTCC TCTGTGCGTG TTTGTGTAAG TGGGTGTGTG TGTGTGTGTG TTTTTTGGGC GTAGAACTGA GTACGTGTGT GGGCGTGGCA GGTAAGGTCT TAATTGAATT TGCTTTTTTT CCAGTTGCGT TGGCCGGGCA ACACCCCTTC GCCAACGAAC GAATTTCCAC CCACCTGCGC GACCAAAAAT TCCACCTGAG CCTACACACA TAGCGCATTT TTGTTGTTTA ATAAGAAAAT TAAATAATTT TTATTTGATT TGCCTGGCCT TATGCAATTT CCACTCGCTT CTTGATTTTT GTTGCCTTCT ACATTTTGAT ACAAATTTTG TATATATATT TTTTTTTTTT GGATATCAAG TATTTTTAAG TGGAAATGTA AATATTTAGA TTACTTTTTG ACTTAAGGCT GAGTTTAGTT TGGAAAAGAA TATTGACCCA TTTAAAACAT TTGAACAGCT TTGATACACA TTTTGAGCGA TTTGCTTTTA AAGACATTCA ATTCGTAAAA CCCATAAAAA GGGAAGAAAC CAGCAAAATG TTAAGCGGCT TGAGTTCAAC TTTTTATGGG CTACCTTTTG CTGTCACACT TTTTTTTCCC CCAAACAACT CTGTTTCTTA TCAACTGTTT GCAGTTACAT ACTTCGTAGC TTCTTAAGGA AACCAAATAA AAGTCACATT AAAATAAAAT AATAAAATAT CAATATGCAT ACCAGCAAAA AAGTGAAAGC AAATTGAATA AAACAATAAT TTGGTATGCA TTTTCAAGTT CAAGTTCCAG AGCTCAAAAG TCGCTGGGTG ATCATGTGAA GATGTTTTCG AATAGCTGAC ATTGCCAATG AGTCGGCGGT ATATCAAGTG ACACAGAGCA CAAAGTATAT CAGGCTAATG ACTGTGTTTC GTGTTCATTA GACGGCGCAG GCCAAAAGAT AACGGCCACG TAAGCCAAGT TGGCCGAAAT GGGGACGAAA AACCGCAGGC GCGGTGAAAA TAAACGAACT TTCAACTTGT CGCCATGCGC CAAGGAGTTG GTCTTAATCC CTTTGGGTAA TGGCTGGTAA TTATCCCTAA TTAGTTGTAA AATATTGAAG TGAAAGTATT TCGGTTCTTT TGCCATTAGC TAAAACTTTT CCAGACCCTT TATCCGTAAT AATGATAATC ATAATAATGG CATAATGTTG GGATACTAAG TAAAAATGCG ATTACATCTG CGCATCAACG TTCCGTGATG AATTTCCCAT CGCCTTTTGT TTTTGGTTTT TTCCTAATGT CATTTTTCAC AAGTCGAAAA TTAATTACCA CACAAAATGT ATTACGCGCA TACACCAGCA ACGGGTTGGT AGTTCAAATT GCTTTTAGCC ATTATGAAAA TTTTCAAAAA AAAAAAAAAA AAAAAAACTA ACTAACCATT AACTAAGAAG CACCACAGTC CATTTTAACT ATGTGATAAA TTTAATTTGC TCTTTAGCTG AATATTATTA AAAAAGTTTC ATATGCAGTG AAAAAAAAAT AGTTGGGACA CCGTCGTGTG TGTCCGCCGA GTGAGCAACG GGTATCTAAT AGTCGTGACA CTTGACTTTG GCGTTCTCTC TTTTTTTATA CTCACAAGTG TTGACCAGAA CACTGTAGTT CCGCTCTATT TTTTTTTTTA TTTTATTTTT TTTTTTTTGG CGCATTTCCC GAAGCTGCGT CATAAATTTA ATTAACGATA ATATCCACGC CCGCTAACGC TAACGGGCAA TGTTTTTTGG TCACAGAACA CGCAGGTGGG TGGCTATGGT TGGATTTGGG TGGCTCTAGG TGGTTTCAAG TGGTTGGGCG GCTGGGTGGC TGGGAGATTG GATGGGTGTG TGGTTTGCCA GAGTCAACCT GCTTAAGTGA CATGCAAAAG CAAGAAAACT GAAGGGAAAG TGGTGC