Note: this item is unavailable.
 
Vienna Tile Information
VT ID VT055847
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200161
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 255847
Nearest Genes
Gene Nr FlyBase ID Distance
Sequence Length 2096
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TACGATTTGTGTCGCCTGGGAAATG
Right Primer GCCGAAAATGTTAGGGGCGATTTTT
Template genomic
Sequence TACGATTTGT GTCGCCTGGG AAATGGTAAC TACAATATAT CAGCTGATCA CCAAGCTAGA CATTCAACAC GCTTCACAGA AGCTAACGAA CTTGCGTTAT GAAAACGCTG ACCTGGCCAA AAAGAACTTT TGAGCATGGA ACGCCTTTTT GCTGGCCATG GAAAACTGAA AATTCGATCG GATCGGATCG CATCGGTTTG GATCGTAGAA AAAAAAAACG CATATGAACA GACGAAACAG TATAACTTCG AATATTTGTG GTCTTAGTCA GAGACATAAT GCCTCGATAT TGGAGCCGAA AAAAAGGTCT TGCTAATGGC TAATGAATGA TAAGGCAACT AGTTCTGGCC ACAAATAAAA TAATCATAAA CTGTGGCAGC TTCTGCGGGC AGAGCGAGCA AGATATAGCG AGTTGAGAAA CCAGAACCAG TTTGCTTATA GAGTGACGAT CTCACACGAA TTTGGTCATG CAAATGTCAG CCGCATATGC ATTAAATTAA GATTCATCAG CGCACGAGTG TCGCCAGTTT GACAGCCACT ACACCATACA GTACATATGT ATGTACATAT ACATATAGTG ACACGCATAC ATATGCACGT CCGATTCGAT CCCTTAACCT GGTCCCACTA TCAGTCAGTT GACACCTTAT CAACTTGCCA AGAACTGGGA ACTGAGCATC GGAAACTATG CCACCTATGT ACATACCGTA CATACATATG TATGTACGTA TGCAGCCGCT ATATCTTATC TGGCCGGTAT GGGGTTTCTT CCAGATACTC GAGGCTTACA CAGCCGACTT TGTGTGGGTA ACATTTTCTT TAATTGACTG CTCCGTTTGC CCCTTTTGGC GGCAATTAGC TGAAAACCCC GCGCTTTTGT TCTCCAATGG AGTATCAAAT AGAGAAGCTG ACACACCGAA ATATATATAT ATATATATAT ATAAATATTT TATGTCGCCC AGTAGTTGGC ACCACGAAGT GCGAACACGC TTTACTCGAT CTCATTCGGC AATTAAATTC ATCATTGAAA TCGATATTCA TTCATCTGCA ATCTTTCAAA GTATTAGTTG TGCTAAAGAT TGGTAGTAAA TTGCTAAAAT TTTACATATG TAAATATTTC ATCGATCTCT TTTAGTCTGA TGCTTTAATC TATAATTTTG CTTAATTACC GTAATGTACA TTATTTAATT GCTATCTGCG AATGATTAAT CAATGCTCTG GCATAGCATT TTATTTATTT ATGTCAAATT TGTTATTAAT TAAGTAGCTT ATCGCTGATA TTTTGCTGTT ATTTTGTTTG TTTGATAGTC GTCTATGGCT GAAGCGATCA GAAACGTATC CAAAAGCGAC TGAGATTCAA ATGAATCCCG AAATCGAACC GAATCGAGTT GAAAATCAAA GTGTTTGCTG GCTTATTAAA GCATAAATAT ATGCAAGTCG CGTAAGGCAA TGGCAAATTA ACGAATTTGC ATAATTATGC ATCGTTTTTT TTGTTTTTTG GCTTGTTTGA TTGCTGCTCT TATGCTTTGT TTACTAATTA ATTGGCGCGG ACTTCAGCGC AGTTTGGCAG CCACTGGGGG GGGGGCGATT CGGAATTGAT TGTTAAATTT ATTTCGCCAT TTGGGCCCGA GCAGCAATTA ATACAAATTG AAATGTGAAT TTCCATTGAA ATGGGAGCCT CCTTTTTTAT TTATCTTCGT TTTCCCTTGA CTTCGTCATG CTCCGAATCA TGACGATGAG GATGATGCAA CTCCATTGGC ATCAAAATTG GGCAGACGCC ACATGGATAC GCGTATATAC ATATGCATAT TGTATATGGA TATATCTCTC GATCGCTGTG AGGCATTTTT TAATTTCCCC CGAAATAAAA AAGCGTTTAA GATTCATGGA AGCGATTGCC GCCGAACAGA AGCTGATGTC ACCCGCATTG TCGATATTTT CATATTTTCA TGTTTCAATT CATTTTCATT TTTCATGTTT CATTTTTCCA ATTTCCGGCG CACTGATTAT GATTAACGAT TAGGATGGAC GCAAAGATCG ATCTGTAATT GGCAGTCAAT TCCGCCAATT GAAAAATCGC CCCTAACATT TTCGGC