Vienna Tile Information
VT ID VT048643
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200158
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 248643
Nearest Genes
Gene Nr FlyBase ID Distance
CG34362 FBgn0085391 1842 bp
CG4815 FBgn0039568 32049 bp
Sequence Length 2162
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer CTTTCATTAGAGCTGGTTCCGCCCG
Right Primer CCGACTTGCAATCTCCATCGTTCCT
Template genomic
Sequence CTTTCATTAG AGCTGGTTCC GCCCGGACAT AGACTCTGGC CGTAGTCCTT GCCGTAACCG TATGATTTCC CCTTGCTCGA CTTTTATTAC TGTAATCCGG CGAGCGGTGA CCTGCAACGC ATGCAGAAAT AAGCAATAAT AATCTGTGTT CAATTTCCAC TCGCCTTGGC CGCAAATTGC ACGCAAGTGA CGACTGCGGA CCGGAAACTA AGTGGAATTC GAACTGGAGA CCCAGCGACA CCACGTTTCC GCAGCTGACA AAATAATTTG AAAGCAATTT CGAGCCCCGG AGGATGAAAA AAAAGGCAAG AAAAATATCC AAATGGGGGG AAAAAAAATT GTCAAATTCG CACTTTGCTG GCTAGCGAAT TTTCGGGCGC ACTGCAATAA TATTTCAATA TGTAATTTGG CAAATTCAAA TTTTTGGCCA GCAACTGCAG CCGAAGTCTC TGGCCCTCCG ACAGCGATAA TTTCCCACAA GAATGCAGCA TTAACACGAG ACACAGATGG CCAAAGGGCC ATCCAAGGAG TGGATTAGAT CGGAGTGCTT AGGGAGGGGA CTTGGATTGG GATTGGGAAG GGTTATTCCG GACAATATAG TCGGGCTCGT ACTGTGTGTT TGTCATATTT GCATGCGCAA CTAAAAAGGT TTCTGGCTGC TGGCAAATTG ATCCCAGCTC ACTGGCTTAT GAAGGACACG GGCTGTACTA TTGTCTGGCT TTCCTTGGAA GGATGCGGAT GCGAATGCGG ATGCGAATGC GGAGTGGGGC TGTGCGGATA ATAAACGTGG CCAGAGCAAA AGAAGCTGGA GCTCTACAGC AGCTCGAGCA GCCAGGCGAG CAACGCAAAA AGCCAACTCT CAAAGGACCT GTGACAGGAT AATGCATGGT TGCATTTTAG ATGACAATAA TGCATTTTTG TTTTAAGGGT AATTTTGCAG AATGTTTTGC TGGCGGCACC GTCGCTGGGG GATTTCATTA TGCGCAAATA TATAAAGAAG TTTTGTTTAT TCTCTGCGAT TTGCAAATGT CTCTCCAACT TCGGTTAAGT ACTGCCATCA AACGGTGGGC CCAACTCGTC CCTGCACAAC AATTTAAAAA TGTATTAAAC TCGCCGAAAG TTAAAAGTAC TTGAAACTTT TGCAGCCAAT TAAATTTGCG AACATCGTCC TTACGCAGCT TACATATTTT ATGGCACAAT AATTTTTCAA TTAGAGACAA AAACATTTTG TCTTCTCCTC GGAGCAATAA ATGAAATATT GGCGACCAAC TTAACAGACA TTTTTGAGTT TATGCTTTTA AGTATCTGCA AATTATGCCA ACCACAACCA CTGCATTCAA AGGTTTATCG AGATCCCCAC TTCATAAATT AGATTAATGT TTATTAGTCT ATAAACTTAT GTCATTATTC TAAACATTTA TAAATATAAG AACAATATGA TCAATTATTT TGGGAGTTTG TATTAAAATT GTCATCTATA AAGAACTAAA TTAAACTTTA AAAACAGTTA ATAATATACT CTTCATTGTT TTCGTCTCGA AAACATCTAG CACTTTAAGA GCATAGCTCA TGAAATATTC AAGATAAACT TCTGGTCGTA CATCAAGCCG GCAGACTTTA GTTAAAGCCA CTTTAAAGCC TTCCACTTGG CAGTTAATCG ATTGGCGTTA GGTCTGTGTT ATGGTTCTGT GCGGGGATTA AGTGAAAAAG TCTATAAAAA TACGCCGGAG TGGGCCGTGT CTGTTGTGCG TTTCCGCCGG ACACGGTGAC GGTGCTCGCC AGCTGCCGTG TCTGGGAGGC TAATCCTCGA CAGAAGCACG TCCTCGTGCT CAACGGAAAT CGCCATTCAA AAATTACGGG GGTTGGCCCG CTCACATGCC GCCAAATGTG GCACGGCAGC AGCTTTGTTT ACTTTTCATT TCCTTCAAGC AGATGCCACA TGCTCCTCAT TCCGGTCGTT CGATGGGTAA ATAAACGGCG GGTTCTGGTT TGGGATTTCC CGCATCTCTG GGGGTCGCAT TTTTTCGTCA CTGGCGGACT AATTTGCAAG ACAATTAGAA GGTCTCTGGC CGAACCAGAC GACGGTCGCT AATGAAAGCG CGCGATAAGA AAACTTAACA AATGTCAAAT GGCCGAAAGG AACGATGGAG ATTGCAAGTC GG