Vienna Tile Information
VT ID VT041432
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status unverified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200149
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 241432
Nearest Genes
Gene Nr FlyBase ID Distance
CG9652 FBgn0011582 23497 bp
Sequence Length 2208
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TAATATCGGACAGCATTAGGCGGCG
Right Primer GAACGATTGGCATGAAAAGGAGTATGAA
Template genomic
Sequence TAATATCGGA CAGCATTAGG CGGCGTAAGT CAGCGACTGA AGGACACCAT TTAGATTGCA GAACACATTT ATCAGTGAGT CTATGTATAT GGTAATTGAA TTTGATTTGA CTTTGAAATA TATCAGTGAT TCATTTAAGT ACTTGAGGAA AAAGGATGAT GGGGAAAATT AGTTGAGAAC TTTTTGATTT ACAGATTAAT ATTCTGATTT TATTCAATAA TTATTTGCAT AAAATTGCGA GTGTTCGACT TTTAGCTTGA TTATTATTTG CAGCTGCTTG ATTTTGCAAT GTCAGCAAAT CCCAATACAT CAAGATCAAT CGAGCGTTCT GTGTTGTTCA CTCTTCATCA ACCATTCGAT GTCGAGCATG AAGTTTTCTC CTCCTGTGAA AAATCTATCT GCTCGCCGTG CTTAATTTCA CTTTCAATTC CTTCTATCTA TCTGCATTTC CTTACCCGCT CCCCCAAAGG ACAAACGGAA TTCAGAATCA GGAAAAATAT TCCATGAAAA CTGTCATTTG CTAGACTAAC CCCACCAAAA TCCATTCCAC TCGGCTCCCC CGTGCCGTGC TCATTTAAAT CCTTTTGCCG TGCCATACAA AATTTGCAAT CTGAATTTTC AGGTCGCCTC GACATCAACT TGCCACATCA ATGAAGCGTT ATATGCTCGC CAACTCGTTA CGTGAACTCG GCTACACAAA AGATGCACAG ATAGATGGGA AAGCTGGGTG GAAAATTCAG CAGGTGGAGC CAGCTGATGC CTCACACCCA CCCACACAAA TGTCGTGTCG TTTTCCATAA GCGAATAAGC TTACCCCAGG TGGCAAGCAG AACAGCAAAA GCAACAGCTA GAGGAAGCGC TACAGCCAAC GGGGCGGTGT GGAAAAAATA TTTTTCTACT TTTGGCTTTT GGCTGAAAAT AGCATCAAAG GATTTATTAT GGTTCTTTCA TGACATGGTG CTATGGGTTA GGGCTGGCAA CTGTCTCGAT TTGCCATAGT TGCCCCCTGT TGTCCATTTT TCCCTGGCCA ACAAAAGGGA TCCAATAGGG ATCCATTCTG AAATCATTTC GTCGGGACTC CAGCTCTAAG CCAACTCCCC GTTTTGCGAC TGCCAGCGAC TTGACCAACG TCATTTTTAA CACAACTCCT ATGCACTGAC AAAAAAAATG GTATTTTAAT CATAATATTT TGGTAGGATT GCTAGAATAT ACTATTATTT TTTATGGCTT CGAAATTGCG TTTGCAATAT TCGCACTTCA ATATTTCAAG GAAACCTAAA CTCTAGTCAT TTTCTCGCAG TGAACATGTG AAAAAATAAA ATAGAATAAT GTGCAGACAA TCGTTTGCCC ACTCAAAGAG CCAAATATGA AGGAATTCAG TTGTGGCTGC TGACACATAA TAAATTTGTG CGTTTGTTCT TGGCCACAAA TGTAATATTC GTATTCCAAA AAACATTTGT AGGATTGCAC TTCTGGGAAC CGAGGCATTG TTGAAAATTT AATTAACACA CAATTGTTGT GGTCCAGCCG GAAAAAGGTG GGGGGAGTGG GTGTTGTTGG GTTGGGGAAT GGCTTGATAA ACTAGTTTCA AGTTTACCGA GCTGACTTTC GACTGACTGC TTTTGTGAGA ATTGCTCGCC ACTGGAAATC AATTTCAACT GCTGACTACA AAGCAGACTA ACATGGCTGA CTGGCAGCGT TTTAGGCCAC GACGACAGCA GGACAAGCTC ATTGTCATTG TCGCAGTCGA GGGAGCGTAC AGATACCCAC ATCCATCCAC CCACCACAGG ACACCCAGTA CACACACAGA CACACATAGA GCGTACACAA GGACACACAG CACCTGAGGC AGCAGAATTT GATTGTCTCT GGAGCTTCCT GCCGGGATAG CGCAGCTGGA GCAACGTGCC GGATATACAA GGTAGATTGA ACTGCGATAA TGGAGCATTT GGACAGCCTT CGGCCCGCTG ACAGATGATG TCATCTGCAG AGGGTGTGAA AAAGCTATAT TTAAGACAGC TGGTCAAAGG TTAAAATACT TGTAAGTATG TTATCTTGAA CTGTTAGCCA ATTATTGATA CATTCATATA CAAAAATCAA CATTGATTTT AAAAACTAAA AGCCCGCAAC AATATATGAA TCTATTAATT ACACCATTTT AGTTTGGCTT CCTCCTAGAA TTCATACTCC TTTTCATGCC AATCGTTC