Vienna Tile Information
VT ID VT000774
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200120
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 200774
Nearest Genes
Gene Nr FlyBase ID Distance
CG4231 FBgn0026397 26758 bp
Sequence Length 2118
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCATGCCTTTTGTTTTCCACTCCCA
Right Primer GCCCGAATAATGTTGCGGTCAATTTC
Template genomic
Sequence TCATGCCTTT TGTTTTCCAC TCCCAACTTT GTTCAGCCCA GCTTCTATTT CTAGTTCAAC CTTTTGTTTG GAATATGTGC CAAAGGGTTC CAAGCTCGTG GCCCCACTTT TCATGAGAGG GTTTTTTGTT TGGCAAATTG TATGCCGGCC ATTAGCCAGT TTAAATTATT GTTAGCTGTA GGTTTAGGTA GTTTATTTTC GGTAAAATCG AACGGACCTC CAAATCGACT TCACTTATTG TCGGACTACT TTGCCTGCTT CAATGTTACT TGAGTAACTT GGAGTTCGCT TCAATTAGCA TCGCTGTGTC CCAACTCAAT TTACCGCGCT CTCTCCACTT AACATTGATT GAAAAATATT ACCTAATTAA ATTACAATTT AGTTTGAAAT TCAAATTGAT TCGCACTCCA CTTAGTTGGA CAGTTGCTTT GCATAATGTA TTTATATTGC ATCGCAATTG CTCAATTATG TATACGCCAT GTTGGCTTGC AGTTTATTCA TAATATTCGC ATTAAATGTG ACGAGGAAAA GCGAAGAACA AAAAGAAGCG GACCAATAAT TTATGAACAA ATAAAATACA TTACCTGCGA CAGGCGTTTC GCTTTCATTT CAATTGACAT GAGGCAAAAC GAAGTCACTT AAATCGCGTG TCCAACATTT AAATCAATTA AATTGTATGT AAGTGGTACA CTGCATATCG GCAATGTAAG GCTATGTAAT ATTCCCAGTT TTTCAAACAA ATCTGAAATT AAAGACACAA TTATAATGAT ATTCGATCGT ATGTTTCTTT TCGCAGCCAA AAAAAGGGAC ATAAATTAGG AAATTAATGT CGGATTGTTT TGAAACGCAC TGTTTTTTTC TTGCAGCTGG CAAGCAGAAA ATTGAAATCA AATCGTCCTG TGTCATTTGC AAAAATTAAT AAATAAGTCA CTTGAAATAA TTTATATGTA CACGCAAACA TAAACACAAG CAGGCACGTG TGCCTACACA TTAAATAAAT ATGCATTTAA ATAAATAATT GGACAGGATT TGTGGCAATT TTTTTAAGCC ATTTACCGTC CACTTTCTAA ATATAATTGG CAAAATGTGT AATTTTAATG GCCAACTACT GTGTGAATAT TTTTGCGGTT TGTTTAATTA TATTTGCATT TCAACGGAAA ATTCCGGACG TCATATACGC AAATGTCAAA CTGTTTTGTG GGCGGGGAAA ATGTGAGGTA AATCAGAATT ACTGCGGAAA TGGCGCTAAA AAGTTCTCTG TTCAAATATG GTTTTACATT TTTATGCCCT CAACTGTGAC AACATGAAGT GGAGTAAACA GACGTGAAAG TGCATTTAAT AAAGCTGGTT AAGGCAAATA GATTTATAAT GTTGAGGGTG CTTCGAATGC ACCAAAATGC GAAGTTTTGG GTTTCTGCAT CAATCACAAT CATCGTGACT CGCTTTTGTT TTGCGGCCAC ATAACCACAT TAAACGAACG AGCCCTTCAC AATGGTCAGC TCCCAAAGGA CTCTGGCTGT TTTTCATTTG CAAAGTCTTT CCTTTGTGCC CGCTGACAAA TGATGCCAGT AAATGCAAGG ATCCGTTACT GCATCCTGCA ACCCAGCGGC AGGACCTTGA TGCATGCCAC TCAGTTAGCA GTGCGGCGCA TGACATCGAT ATGCCTAATG AAGTGATGCA TGCACGTCCT TACATCTGCG TCAGGATCCT CCTGTTTTCA GCACTAATCC TACAACAGAG TCGCCAGACC AAAACTCAAT CTGGGCCCGC GTGGATACTC GTATTTGTAT GCGTTGCATT CAAGCGCCGC CAATCCTTGC GTAATTCCAA TAAGCTAAGG CTCGCTGGCA CAAGCACACT GGTTACGAAA ATAAATATAT AAAGGGGGAA AATAAACAAA ACAATTAAGC AAACACTTGC AATTATGCAA AATAGCTTAT GGAATATATT ATAAACTTAA AGGTTAAAGG TAAGCGAGCA CATAACATAG GTATATTTGT ATAGGCTTTC CTATAGTGCT ATATTTGTAA ATAGCCTTTC TTAGATCCTA TCCATTTCTT TCAGTGTAGC TGTGGACATG GTCCAGGATA ATGAAATTGA CCGCAACATT ATTCGGGC