Vienna Tile Information
VT ID VT050660
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200107
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 250660
Nearest Genes
Gene Nr FlyBase ID Distance
CG2098 FBgn0024891 8425 bp
CG1976 FBgn0039883 10084 bp
Sequence Length 2108
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCGAAAAGTGTCCAACTAGGAAAACCA
Right Primer AGAGAGAAAATGCCAAAGCCCACCC
Template genomic
Sequence GCGAAAAGTG TCCAACTAGG AAAACCAATA TTCCGAAGTC AAATATATTA TTCGATTTGT ATGCCCACTT TTCTCACAGT GCCGTCGTCG TCACGGATAC ATCGCAGAGG TAGAAAGTTT TGCCCAAGAC AAACACTGCC ACAGCATTTC TCTCCCCATT GTCTTCCGGC CAACTGCTCC CGATATTCTT TTGCGATTTC TTTTGCCATT TTGTTGCAGC TTGCTGGCTC GACTACCGCG CCCGGGAACA GCGTTTGCTG CACCTCCTGG AATCCCACAT CCCATTCTAT TGTTTTTGTT GCCAAATGAT TTTGAAAAAA GAACAAGCTA AAACTATTAA TTGGCAACGC AGGTGTAGCG GTTTTCTAAT TGCTGCCAAC GCAGCGCTAA AACTTTTTCT CTCTTGGAGC TTAATAATCT TAATTTTGGG TGCATTGACT TGGAAAGAGC TCTGATAGAG CCAAGTAGCT CGGAAGCTCG TCCCTTTAGG CATCCAGCTT ACTGTTCGCG GAATAATTTG ATGTGTACCA ATTTTAAAGC CAATATGGTA GCTCGCAGTT GTCCGCTATA TCTATCACAG CAACTTACAT TGAGCAAACG GCATTTAACC ACAAGCAATT AACTAATTGA TTAATCAGCG AGTTAAGAAG CAACCGTATT TGGGCGAAAG CAAGCTAAGA TTCCTTCCGC TTTTCACCCG CTGCACAACG CGTGCCAACT GGCCCAAAGA TGGGTTCCGA GGCTCGCAAG CCTTACCTTG TTGGGGAAGC TTACGTGCCT CAAAATCCTG TCCATACTTC TTCTGCTCGA CTGGCTTCAG CTATGTACGT GCCCTTCATT TGCGCAACTA ATTGCAAAAG TCTTACGCAA CTACGGGAGA CAGTCGTCAG TAGTGAGTGT CGACGGGCGA CGTATTGAAA TGTTGTCGTG TTTATCGAAG AGTCGAGTTT GTTGCGTGCA CGTAAAATAT TTGCCTGTCA CTGGGCCGCT CTTTCCCATC GGGGGACTGT CGAACGTGTT TATATTTTGT AGCCGGCCGA ACCATGTTCA ATCCTCTTGA CAGTTGACTT ATTGCCGGGA TCCAAGCACC AAGGTCTACG GATCCGGGGG TCATACCTTG GGATCGCTCT TAACTAATTT TTAATTATTG CCGTCGGCCG GGCGGCCCAT TAAAATGATG AGCGGGATTA GACCAGCCCC CTTGTAATGC TAATGGGCTG CCCATCGGCT GAGCTGAGCT AAACGCTGCT CTGCTTTTTG TGTTTTCTGC TCTTGGCCTG GCTGGCTGAC TTTCGTGGGT TTCGGCTGGC GTTTAAGTGG CAATGCTGCG TATGACACAA TTTATTTTTG GGCCATGAAA ACATCAGCTT CTCGCCGAGC TGCGAGCATC TGTGTGCGGA GGAAATTGAG GACACTTTTT TGCAAGCAAA GTTGCATAGT TGCCAAAGAG TGATGGATGC ACTGAGAAAA GCATTTGGAG TTAACATTTT AGTTTAAATC CTTAAATTTG TTGCTATGCT ATATTTTCAA GCCGAGCTAA GCAAAAGATA CAACTTGACA TGGCCGATCG ATTTGAATTA CGTTCTTGAT ATTCTAATAT GAGTGGACGA ATCCGAGATC GAATCTGGAC AGCTGCAGAA AGTGCAGTCC TAAAACGAAA TTAACCCACG GCCTGCAGTC GTACTGAAGG CAACATCCAC GCACACATCC ACATCACGAC GCCAGTGCGC TAGTGTGCGT GGGTATCTGT GTGCGCACTA AAAGCGGTTT ATGCCACTCA CATGTAAACC CAGTTGCCTG CCAAGTGTTT GGCTGTTTGG ATTCAACACC CACACACGAT TGTTGTGTGG ATAGGTCGTG GCTTTGCGTG TTTCAAGCAA CTGAGCCACC CACTCGGCCA CCTAGCAGCC CCATTCTCCT GTGGGCTGCT CAAATTTTCT GTTTGCTTTG CTGTGGATTT CGCTACGTTT CGGCGGAATT CCCCCTGCCA GCGTCATCAG CCCAACTTTT TACTTTTCGT ACCTTAAACG TATTTTGCAT TTGCTTGGCA CAGATCCGAA GGGGTTGGTG GGTTAAGGTT GGCGGGTGGG CTTTGGCATT TTCTCTCT