Vienna Tile Information
VT ID VT041043
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200099
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 241043
Nearest Genes
Gene Nr FlyBase ID Distance
CG14372 FBgn0038156 4338 bp
CG17025 FBgn0040554 4522 bp
Sequence Length 1334
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer TCCCAGTTAATCGGGGTGGACGTAA
Right Primer CATCACAGTTGAGGGGCAGGAGG
Template genomic
Sequence TCCCAGTTAA TCGGGGTGGA CGTAACTCTA TCCGCAGGTC GGCCGTTTCC ACTGCAGAAC TGCTCGGTGA CCAATCAGTC GGTGGACTCA CTGCAAGTAG ACTGCCTGGA GGGATTCGAT GGAGGTCTTC CGCAGGGATT CATGCTGGAG CTGGTCGAAC TGAACACGTT GCGTCTGGCC AGAAACATCA CGGTTTCGGT AAGCTTCAGA ATTGGGTTAA TAAGCACGGG AATCTTAATT ACCCAGCGAA TCCATTAAAC AACTTTATCG GCGACTTACT CTAATCAATG GGGGTTTAAA GTAATTAATT GCCTCGCAGT GTTCAGAACA GCAGGAGATA AGCGGATGGT AATATTGTAT ACTTTGGGGC TCTGCGCTTA CATTTTTAAG TTGCCAAAAA ATAATATAAT TTGTAACACC GTGAATAAAT TATTTTGTTG GATTTTGCGA GATTAAAAGC TAATGTGGGT TAGACTTGCA GTAAATTATT AGCATCATTT GAATATATTC CTAGTGGTTA GATGTTTTTC TATCCAGATA AGTTCCTCCT CCTCCTCCTT TAAATTAGAG TTAGAATTCA ATGGACGCTT TTTATTTTTA TTTTTTACCG AATTTGGATG TTACGTTTTG TAAGTTCAGT AAACATTAAA GTTCGAGTAA ACAGGAGGAG AAGTTCAGAG AAATTTATAA GGATTTTTGC GTTTTTAAAC TTCTTCTGAA AGTAATTATA ATTTTTGTTT TGTTGGTTTT TCTTCTACCC GAAATTATTT AGCATACACC GGTGACCTTT GTGATAGACA ACCTAGACCA GGCGGCTACC TATCGCATGG TGATATTCGC CGTAAATGCC AAAGGTCGTT CGGAGCCCAC CATAATCGAC GACATCAATT TCAAGGGCGT GGCCAAGTTC ACAGGTGAGT TGCGGTTGGG GCCCAAGAAC CCAAGTAATT GGGAATTATG TGGTAATAAT TTATTTGCGG CATTTCGCAG GTGCCTCGAC CGGCCTCTCG ATGCCCCTCT CCCCATTTCT GGCGGGTCTG ACCCTTTTCT GCGGCCTGCT GTTCGCCATC TTCTGCATCA TGCTGGCAGC CATCTACCGA AGGATTTCCA ATCGGTACGG ACACCAAAAC TAAGCTAATG GCTAATGGCT GCGGCTTTGC TCTAATGGCC CCATTTAAAT TGCAGGCGCA GCGACAGCAA TCTGAAGGTG GCCAAGCACA CGCAGCTCAC GATTCCGGCG GACTGCCAGC TGGACCCGTT GCATCCGGGC GTTCAGACGG ACGGATCCGG CAACCATCAG CCGCACCACA GCCTCCTGCC CCTCAACTGT GATG