Vienna Tile Information
VT ID VT019579
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200085
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 219579
Nearest Genes
Gene Nr FlyBase ID Distance
CG8896 FBgn0004364 1850 bp
CG16898 FBgn0034480 102533 bp
Sequence Length 2144
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer GCAAATCGCTGTGGTCTGTGCTTTT
Right Primer GTTCCTCCTGTTGCTGCTGCGTTTC
Template genomic
Sequence GCAAATCGCT GTGGTCTGTG CTTTTTTTGT TTTCGTGGAA TGCTTTTCAG GTAGCCAAAA ATCCGGCCAT AAGTTTTCGG TCAGCCTCTA AGCGAGAGAC ACATGGCCCG CGAACATAAA TCAAACCGAC CAATAAATAC TTGCGGCCGG GACTCGAGAT TCTACATAGC CACAGAGCAG TAAACGCGTA ATTAACCCCA TTCTCCGCGA AGGAGCAGAG AAATATGGCA CAAGAGTTAA TGCACATTAA AGCTCATATA TCAACCCCTA CACAAATCAA GGGGGCTGAG AGTTGGGGCC ACAATAGGCA GCCTTTGCAA GAGCCTCAAA TGCTGGCAAG CCACTCGAGT CGGCGAAGCT AGCACAATGC AGCAAAAGTA TCTTTAAGAT GCACTTGAGC GGTCGTCGGC ATCTCTCCTC TCGTTACTCA TAGCATATAT ATATATATGT GTTCCTCCAC CGATGGGTTT ATATATTTTA TAAAATATCG CATGTCATAT AAAAATGCCT GGCATTGTTT CAGCATCGAC GTGTGGGCGC ATTACTGAGC CCGCATATCA AATGAGTCCT GAGTTCGAGA CAGAACACAA AAACAACGGC AGCAATAGCA AATCACACTA TCGAACAAGA ATTTTTAAGA TAGAGAAATA CCAAGCAGAC ATTATAGCTG ATGGGGATCT TAAGATATGT GGCTTGAGAT AAAATCAATG TTTTGTCTGA AATAAATTAG TCAAAAAAAT TTCCCTTTTG GGAGAGTTTG AAGTGAATTA ATAACTAAAT AAAATCATTA TTGGAATTTA TATAACTCAA AGATCGTACA GTTTTTATCT TTTCTAAATC TCCACAGTTT GTTATCTTAG CAATGGTAAT AATGTTCGAT TTGTTGTTCA GTTTAACCGA TGCGGAGGCG GCAATAATGT AATGCAAGTG CGCCTGACAG CTGCCACCAG GATGACTCCT TCGATGGGGA TTTCCATTGC TGTCACACAC ACTTTCCACT CCAGCAGTGC AACGCGGCAC ACATCCATTG ATGGCCTTCT TATTCCCGGG TTCATTCATT AAAGCGCCAG CAATGATATT CATAACTGCC TTTTCAACTG CCATGGCAAT TTTCAATCGC ATCCAAAAGA TTATGAAAAT TTTGGCCTCA AAAAATCGGG CAAAACGCTC GCCGCGTTCG CATTCGGTAT TCGGATTTCG GATTCGCAAC AGCAGCAGCG CAGCAAAATG GAAAATAACT GAAATCACAA AACAAACTTA GTGCGCAAAC ATAAATTATG CATTACAAAC GTGCTTCTGA CCCATTGCCA TTTTCTAATT CAATTAAAAT GGTTTTTGTT TCTCCAGTTG CTGCTGCAGT TCGCTGAGCC AAGCCTAAGC ATTTGAATAC GATTTCCCAA GGAGCGGAGC GGGAAAGTTT CTGAATAGGC CGCTGGGAAA GTTGGAGCAT CGCATCCAGG CAGCCAGACA CTAATTTGAC ATAGTTATGC GAGTCGAAAT GAAAGCTGCA ATGAGGATTT TGGCCGTGGC CAACGCGGCG TATGAATAAT ATTTAAGCTG TGGTAGTTGC CGCTGCAACA AACAAACATT AGGCCACTTT TATGGAAACC TCCTGTAAGA CACTTTTGGC CAAGCAGGTA CTTGAAATTC CCATAATGTC CAAAGAATGC TAGTAAACTT TTCACTAGGC GAAATTTTGA AGAGTTAACC AACCGAAAAA AGCCTCATTT TTGAACCATT TTTAATCTGG TTTCAAGCTG TACAAAAACT GCCACTATAG TTATGTCGGC TTGAGTCTGC CCGAAGAAAC AGAAAAGGTC GACGACACAC ATATGACAAA CTCTGCCGCA AAGTTGCTGG CACATGTCGA GTTAATGAAA TTTAAAAATT CATAAAATAT TCGCACCACT AGGCAAACAG CAGTAAGAAC CACGACGGCA ACATCTACAA TCCCAACAGC AGCAGCAACT GCAAAGGGGA AGTGTAACTC AATTAATTAA TAACAATATA CCAGCAGCAG CAGCGGCAGC AGCACCAGAA ACATTAACAA GAACAACAAA CAAAATAATT AAGTAACAAA AGTTTCATAT TTGCAACGCC ACAAAAACAA AGCGGGACAG AAACGCAGCA GCAACAGGAG GAAC