Vienna Tile Information
VT ID VT057467
Library VT-GAL4 Stocks (VT-GAL4)
Transcriptional Activator GAL4
Landing Site attP2 (chromosome 3 at 68A4)
Verification Status verified
Link to BrainBase view BrainBase images
Link to FlyEnhancers view FlyEnhancers details
Link to UCSC Genome Browser view genomic mapping position
Link to FlyBase view FlyBase Recombinat Construct Report
view FlyBase Sequence Feature Report
view FlyBase Insertion Report
view FlyBase Allele Report
view FlyBase Stock Center Record
 
DETAILED VIEW
VDRC ID 200018
Library VT-GAL4 Stocks (VT-GAL4)
Construct ID 257467
Nearest Genes
Gene Nr FlyBase ID Distance
CG15765 FBgn0029814 6650 bp
Sequence Length 2102
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 3
Left Primer ACTTGGTTTTGGCCCACAGCTTGAC
Right Primer GTGGTGCAGCGGACATGGAGTTT
Template genomic
Sequence ACTTGGTTTT GGCCCACAGC TTGACCCCAA GCGTAAATTA ATGTGTCGGA CATTAGGCCC CAATGATGAT GAACACTGAA ACAAATCAGG AACACACACT GCTCTCATGA TTTTTAATTT AGAAAACAAA AACTTGCAAG CAATGAATGT AGCCCAAACC CTTGAGCCCA ATCTATGGTA ACAGTTTTGG CCTTATCCCC AGTGTGTTCG CATCATCCTA CAATCGCAAT TGACAAGGAC GATAATGAGA AGGATAATAT GATGTTGGGT GTGCAGAATG CCCAACCCCC TTCTTTCATT GGCCCATCTG GGCAACATCC TTGTTGTTGA AAACATTATC GTTCACTTGG GCATCATTGA TAACAAATGC TGGCCCATTA ATCGGGCCAC TTTCCTCACT TTCGTTACCG AGCTGCCTGA TTAAACACCA AAAAGAAGAA AGAACACACA CCCACATGGG CAACTTCTAA TGTGTGTGTT AAACTTTTTT ATGCCTTCAG GCCTTGTTTA ATAATTGAAC AATAAAGAAC GAACGGCATT AAGTAATTTG TGTCGGTTAA GTCATAAAAC TCACACACAA ACCCACACAG GCACATATGC ATACATGCAC ACAACGCCCA CACACACACA CGCACACATA GTCGCATAAA TTGTTAATTC AGTGCTCAAG TTAAATGAGT CGTTGGCATG AAAATTTCAA GTTTATTGCA GACGAACTGG GGTGCCCAAT AAATTTTAGC TTGCGTGCCT GAGCATTGAA CACCATCCAA ATGGGCAGGG TCGCACGAAA GGGGGGGCGG GGGGTGTGTG TGTGTGTTCC CCCTCAGCAT TTTAGTATGT TTACTAATAC CTCTTTACTA CATAATAATT ACAAAATGTA CAATATACGT TCAATCGTAG TTAACTTTTG ACTTACTTTT TAGTTAGCAT GTAAATGCAA TCGTTAGAAA AATGTATGCC CCTCGTAAAA AGTTGTGTGT ACGCCCCTGT GCACCAAACA ATATCCCCCC CCCCCCCCCT TCCCACTCAT GCTCGACAGG ATGAGCCATT GATTCATGTT AATTAAATGT GACAAAAGTT GAGAAACTTT TCCCAGGCGA CTTTCTGCCT TGCTGGCTTT CTGCCTTTCG GCCTTTGCCT TCCCCCGATT GCCATTGTCC TTCGCTGCAC ATTTTCATTT CGGCCATGTT GCGGTTTGCT TTATGGCCAA TCTAGCCAGT GTACCAGCCA CCCACAACTG AATGCCACCC CGTGCATAAT GTGCGACAAT TTCGATTGCG ATCATCTGGC CAAAATGTTG CGGAGCAAAA GTTTCTGCGC TTTTAATTAG AATTCGAAGC GAATCCGCAA GCTGTCCAAG TTTTATCTGG GCCATGATAT TGGGATACCT AAGGGAAGAA TGGCTGACTG GCTTGGCTGG CTGCATCACC GATTCCCTGC AGGGATTTGG GATTTGGTGC GGAAGGACTT AGTTTTCTTT AGGAGCAGGC AAAAGTTTAT GCAACGATTT GCCAACTCGA AGGTGGCCGG CGAAAGGGGC GGCCACTGGA TTATCAGCAC TTTTATATTA TTTTCTTTTT TTTTTTTTGC ACAGCGACTT GGAAATAGGG TGGCAGTGCA AACTTAAGCC TGCCGCAATC AACTTTCCAT GGGAAACTTT ATGATATCGA TGGACTGTGG TCGCCAACAG CAGCAACTTA GCCGAAGATT ACTACTCAAC CGCTTTGCAG CAGAGCATTT ATTTTCCAAT TTTTGAATGT TTGAATTCAT TCGATTCATA TTTTGTCATT TTCAATTCAA AAAACACATA AGCCCAAATG GATTATCAAA GGCACGAGAA GGAATAGTCT GTGCAATGCA ATTTGCAAGC TGTTTTAATA ATGCAACGAT CTGTATTATT CAGTGGCGAC GCTTGATATT TATTCATGCC GCCTTGCATT TAAGATTCCT GCTGCCAGCA CATTTTGCAA ATTGAACAGA TGCCAATCCA GGAGTATATA AAACCGGGCT CTCAACACCC CACCCAATGC CACTATCTGG CGGGGGAGTG AAGGATAATG CTTAGCAGGA ACTCCGAGCA AACTCCATGT CCGCTGCACC AC