DETAILED VIEW
VDRC ID 991
Library GD Stocks (GD)
Construct ID 104
CG Number (r6.01) CG18402
FlyBase gene number FBgn0002393
FBgn0000457
FBgn0000456
FBgn0010868
FBgn0013984
Synonyms 18402
DIHR
DILR
dinr
dInr
dInR
dINR
DInr
DInR
dInsR
dir
dIR
DIR
Dir-a
Dir-b
DIRbeta
dIRH
DIRH
Drosophila insulin receptor
Drosophila Insulin Receptor
er10
inr
inR
Inr
InR
INR
Inr-alpha
Inr-beta
INS
InsR
Insulin
insulin/insulin-like growth factor receptor
insulin-like receptor
Insulin-like receptor
Insulin-like Receptor
insulin receptor
insulin-receptor
Insulin receptor
Insulin-receptor
Insulin Receptor
insulin receptor homolog
insulin receptor homologue
IR
l(3)05545
l(3)93Dj
l(3)er10
lethal(3)93Dj
lnR
Hairpin Length 204
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability lethal
Inserted Chromosome 3
Left Primer CGCTCTAGACGATGGCGGTGTTATGGAGAGG
Right Primer CGCGAATTCCGCTCCTTTTCCCGATGCTG
Template genomic
Sequence CGATGGCGGT GTTATGGAGA GGCCGGAAAA TTGTCCTGAT TTTCTGCATA AACTAATGCA AAGGTGCTGG CATCATAGGT CTTCGGCGAG ACCCAGTTTT CTGGATATCA TTGCGTATCT CGAACCACAA TGCCCCAATT CACAATTTAA GGAAGTATCC TTCTATCACT CAGAGGCAGG TCTGCAGCAT CGGGAAAAGG AGCG