DETAILED VIEW
VDRC ID 9379
Library GD Stocks (GD)
Construct ID 661
CG Number (r6.01) CG7395
FlyBase gene number FBgn0036934
FBgn0044367
Synonyms anon-WO0131005.1
CG18639
CG7395/CG18639
CT22771
Drm-NPFR76F
Drm-sNPF-R
GPCR60
Neuropeptide F-like Receptor 76F
neuropeptide-Y-receptor
NPFR76F
short neuropeptide F receptor
Short neuropeptide F receptor
snpfr
sNPFR
sNPF-R
sNPFR1
sNPF receptor
Hairpin Length 269
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCGGAACGCAGACAGGCAACGAG
Right Primer CGCTCTAGAGAGATGATGAAGAAGGGCAGCACAA
Template genomic
Sequence GGAACGCAGA CAGGCAACGA GACCCTGGTG GAGGCCACTC TAATGCTAAA CGGAAGCTTT GTGGCCCAGG GATCAGGATT CATCGAGGCG CCGGACTCTA CCTCGGCCAC CCAGGCCTAT ATGCAGGTGA TGACCGCCGG ATCAACGGGA CCGGAGATGC CCTATGTGCG GGTGTACTGC GAGGAGAACT GGCCATCGGA GCAGTACCGG AAGGTGTTCG GTGCCATCAC AACCACTCTG CAGTTTGTGC TGCCCTTCTT CATCATCTC