DETAILED VIEW
VDRC ID 7916
Library GD Stocks (GD)
Construct ID 1695
CG Number (r6.01) CG3595
FlyBase gene number FBgn0003514
Synonyms DmMRLC_C
light chain of nonmuscle Myosin II
MLC
MLRC
MRLC
Myo
myoII
MyoII
Myo II
Myo-II
myo-II regulatory light chain
Myo-II regulatory light chain
MyoII regulatory light chain
myosin
Myosin
myosin 2
myosinII
myosin II
MyosinII
Myosin II
Myosin-II
myosin-II light chain
Myosin-II light chain
myosin II regulatory light chain
Myosin II regulatory light chain
Myosin LC
myosin light chain
Myosin light chain
myosin regulatory light chain
Myosin regulatory light chain
Myosin Regulatory Light Chain
NMM
non-muscle myosin II
nonmuscle myosin II
non-muscle Myosin II
non-muscle myosin II regulatory light chain
nonmuscle myosin II regulatory light chain
phospho-Myosin light chain 2
regulatory light chain
regulatory light chain of Myosin II
regulatory light chain of nonmuscle myosin II
regulatory light chain of nonmuscle myosin-II
regulatory myosin light chain
RLC
RMLC
sgh
spaghetti squash
spaghetti-squash
Spaghetti squash
Spaghetti-squash
Spaghetti Squash
Spaghetti-Squash
spg
sqh
Sqh
squ
Squash
ssq
type II myosin regulatory light chain
Hairpin Length 264
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGCCGAGTTCAAGGAGGCATTCA
Right Primer CGCTCTAGAGGGCAGGACGCCCATATTCTC
Template genomic
Sequence GCCGAGTTCA AGGAGGCATT CAACATGATC GACCAGAACC GTGATGGCTT CGTCGAGAAG GAGGATCTGC ACGACATGCT GGCCTCGCTG GGCAAGAACC CAACGGACGA CTATCTCGAT GGCATGATGA ACGAGGCGCC CGGGCCCATC AACTTCACCA TGTTCCTCAC GCTCTTCGGC GAGCGGCTGC AGGGCACCGA TCCCGAGGAT GTGATCAAGA ACGCCTTCGG CTGCTTCGAC GAGGAGAATA TGGGCGTCCT GCCC