DETAILED VIEW
VDRC ID 7819
Library GD Stocks (GD)
Construct ID 1566
CG Number (r6.01) CG15792
FlyBase gene number FBgn0010524
FBgn0265434
FBgn0002742
FBgn0004415
FBgn0026658
FBgn0005634
FBgn0044594
Synonyms anon-WO0140519.37
cytoplasmic myosin
cytoplasmic myosin heavy chain
cytoplasmic myosin II
cytoplasmic myosin-II
DmnmII
Dm nmII
DROMHC
Dronm-MII
E(br)
Enhancer of broad
l(2)02957
l(2)17F1
lethal (2) 17F1
MHC
Mhc-c
Mhc-c[1]
Myo
Myo2
myoII
myo II
MyoII
Myo II
Myo-II
Myo-II HC
Myo-II heavy chain
myosin
Myosin
myosin 2
Myosin 2
Myosin-2
Myosin HC
myosin heavy chain
Myosin heavy chain
Myosin Heavy Chain
myosin-heavy-chain-cytoplasmic
Myosin heavy chain-cytoplasmic
myosin II
Myosin II
Myosin-II
myosin II heavy chain
Myosin II heavy chain
myosins II
NMM
nmMHC
NMMII
nmy-2
non muscle myosin
non-muscle myosin
non-muscle myosin heavy-chain
nonmuscle myosin heavy chain
non-muscle myosin II
nonmuscle myosin II
non-muscle Myosin II
Nonmuscle myosin-II
non-muscle myosin II heavy chain
nonmuscle myosin-II heavy chain
nonmuscle Myosin II heavychain
zip
Zip
ZIP
zip/MyoII
zipper
Zipper
Zipper heavy chain
zpr
Hairpin Length 259
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGCCTTCTGTCGTGGCTTCCTTG
Right Primer CGCTCTAGATGCGCTCGTACTCCTGCGTATTCT
Template genomic
Sequence GCCTTCTGTC GTGGCTTCCT TGCGCGTCGC AACTACCAAA AGCGCTTGCA GCAACTAAAC GCTATTCGAA TCATCCAGCG GAATTGTGCC GCCTACCTTA AGCTTCGGAA CTGGCAGTGG TGGCGCCTCT ATACTAAGGT CAAGCCCCTG TTGGAAGTTA CAAAGCAGGA AGAGAAGCTT GTCCAGAAGG AGGATGAGCT GAAGCAGGTA CGCGAGAAGC TTGACACTCT GGCCAAGAAT ACGCAGGAGT ACGAGCGCA