DETAILED VIEW
VDRC ID 7161
Library GD Stocks (GD)
Construct ID 1484
CG Number (r6.01) CG14228
FlyBase gene number FBgn0013951
FBgn0014341
FBgn0086384
FBgn0070004
Synonyms BG01543
D-Mer
Dmerlin
D Merlin
Emr2
EMR2
Ezrin-moesin-radixin-2
mer
Mer
merlin
Merlin
Merlin/Neurofibromin 2
NF2
Hairpin Length 342
ON Targets 1
OFF Targets 1
s19 1
CAN Repeats 3
Viability viable
Inserted Chromosome 3
Left Primer CGCGAATTCGGCTGCGCGAGTCTTGGTACTTT
Right Primer CGCTCTAGACGGCCAGCATACCGTCCTTG
Template genomic
Sequence GGCTGCGCGA GTCTTGGTAC TTTGGGCTGC AGTACGTCGA CACCCGCAGC AACGTGTCCT GGCTGAAAAT GGAGAAGCGG GTGCGCGACC AGCGCGTTGA GCTGCACGCT AGCAATAATG TGTATGTGTT TAGCTTCTAC GCCAAGTTCT TTCCGGAGAA CGTCAGCGAG GAGCTGATCC AGGAGATCAC GCAGCACCTG TTCTTCCTGC AGGTCAAGCA GAGCATCCTC TCCATGGACA TCTACTGCCG CCCGGAGGCG TCCGTGCTGC TGGCCTCCTA CGCGGTGCAC GTGCAATACG GTCCGTACGA CTACGAGACC TACAAGGACG GTATGCTGGC CG