DETAILED VIEW
VDRC ID 6692
Library GD Stocks (GD)
Construct ID 84
CG Number (r6.01) CG7223
FlyBase gene number FBgn0010389
FBgn0022791
FBgn0004599
Synonyms CT22273
CT39172
DFGF-R1
DFGF-R2
Dfr1
Dfr-1
DFR1
DFR-1
DFR1/DFGF-R2
DmHD-38
DPR3
dtk1
Dtk1
DTRK(FR1)
EMS2
FGFR
FGFR2
FGF-R2
FGF receptor
fibroblast growth factor receptor
Fibroblast growth factor receptor
Fibroblast growth factor receptor 1
Fr1
FR1
HD-38
heartless
Heartless
htl
Htl
HTL/FGFR1
i100
i150
i79
j372
Tk1
Hairpin Length 216
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCTCTAGAGCTTGGTGCGGGAAATGGAA
Right Primer CGCGAATTCTCACATGAGCTGGTGGCGATG
Template genomic
Sequence GCTTGGTGCG GGAAATGGAA GTGATGAAGA TCATTGGGCG ACATATCAAT ATTATTAACT TACTTGGTTG CTGCAGTCAA AATGGTCCGC TCTATGTGAT TGTCGAGTAT GCGCCACACG GAAATCTCAA GGACTTCCTC TATAAAAATC GACCCTTCGG AAGGGATCAG GATAGGGACA GCTCGCAACC GCCGCCATCG CCACCAGCTC ATGTGA