DETAILED VIEW
VDRC ID 60103
Library RNAi-TK (RNAi-TK)
Construct ID 60103
CG Number (r6.01) empty
FlyBase gene number
Synonyms
Hairpin Length
ON Targets 0
OFF Targets 0
Viability viable
Inserted Chromosome 2
Left Primer CTGACTGAATTCGGACGACGGGAACTACAAGA
Right Primer CTGACTGAATTCGGACGACGGGAACTACAAGA
Template genomic
Sequence GGACGACGGG AACTACAAGA CACGTGCTGA AGTCAAGTTT GAGGGAGACA CCCTCGTCAA CAGGATCGAG CTTAAGGGAA TCGATTTCAA GGAGGACGGA AACATCCTCG GCCACAAGTT GGAATACAAC TACAACTCCC ACAACGTATA CATCATGGCC GACAAGCAAA AGAACGGCAT CAAAGCCAAC TTCAAGACCC GCCACAACAT CGAAGACGGC GGCGTGCAAC TCGCTGATCA TTATCAACAA AATACTCCAA TTGGCGATGA CCCTGTCCTT TTACCAGACA ACCATTACCT GTCCACACAA TCTGCCCTTT
Genotype
Comment Control line for KK library. UAS sequences drive expression of a 320bp fragment of mRNA for green-fluorescent protein from jellyfish (seq. X96418.1 nts 208-413) organised as an inverted repeat for RNAi. Construct inserted into KK line host strain at 30B landing site. No insertion at 40D site.