DETAILED VIEW
VDRC ID 52126
Library GD Stocks (GD)
Construct ID 7334
CG Number (r6.01) CG33531
FlyBase gene number FBgn0031797
FBgn0053531
FBgn0031796
FBgn0031793
FBgn0031795
FBgn0031794
Synonyms CG11573
CG13984
CG13985
CG9488
CG9490
CT33540
Ddr
DDR
Discoidin domain receptor
Hairpin Length 332
ON Targets 1
OFF Targets 1
s19 0.99
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCGCCAGCGCACGCAACTCTCT
Right Primer GCGTCTAGAACGCCGGAGCCCAGTTTCTC
Template genomic
Sequence GCCAGCGCAC GCAACTCTCT TAATGCGGCC ACACTGCCGC TACCTTCGCC GCCCGTGCCA CCGCCGCTGG AGAAATATTA CGCAGCAACG CCAGTTAGCA GCAAACCCAT GCCAGTGGCG CCGCCGGGAT CCCAGAGTAG TGGATCCCTT AGTTCTTCGA CTACGGCTGC GACCACGCCC ACCAGTGGGG TGGTGGGCGT AGGCAAACCG CATCATTACA ATTTGGATAT GAGCGCAAAT TTCGCCGACA TTAACGAGGA GCGGGCCAAT TGCCAAGTGC AGGAGTTTCC ACGTCAGTCG CTGGTCATCG TCGAGAAACT GGGCTCCGGC GT