DETAILED VIEW
VDRC ID 51468
Library GD Stocks (GD)
Construct ID 1333
CG Number (r6.01) CG1451
FlyBase gene number FBgn0039604
FBgn0015589
Synonyms adenomatous polyposis coli
Adenomatous polyposis coli
Adenomatous Polyposis Coli
adenomatous polyposis coli 1
Adenomatous polyposis coli 1
Adenomatous Polyposis Coli protein
apc
Apc
APC
apc1
apc 1
Apc1
APC1
APC-like
dApc
dAPC
d-APC
DAPC
D-APC
dAPC1
D-APC1
Dm APC1
Hairpin Length 310
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability viable
Inserted Chromosome 2
Left Primer CGCGAATTCAAGCGGATGCAGAAGCGGAAG
Right Primer CGCTCTAGATGGGTGGGAGGTTTGGTCAGG
Template genomic
Sequence AAGCGGATGC AGAAGCGGAA GTCAAGCCAG AAGTTCGCGA GGTGACTTCC AAAGAAGGAG CTCCCAAAAA GCTTCCCAAG CTTTCGCAGT GTGGCTCCGG TTCGTACACT CCAGAGAAAC CCATTAACTA CTGCGAGGAG GGAACTCCTG GGTACTTTAG TCGCTACGAT TCACTGAGCA GCTTGGATGA ATCCGGTAAG GCTAACCAGG CAATAGTAGG AACGGATGCG GATATCAAGC CCAAATTAGA GAAGCAGGAG GAACAGGAAT CCCAGCCAGC AGAGCAGGTC CTGACCAAAC CTCCCACCCA