DETAILED VIEW
VDRC ID 50176
Library GD Stocks (GD)
Construct ID 578
CG Number (r6.01) CG3022
FlyBase gene number FBgn0031275
FBgn0046594
FBgn0046602
Synonyms anon-WO0170980.13
anon-WO0170980.14
D-Gaba3
D-GABA[[B]]R3
GABA-B-R3
GABA[[B]]-R3
GABA-B receptor subtype 3
GB3
metabotropic GABA-B receptor subtype 3
Hairpin Length 264
ON Targets 1
OFF Targets 0
s19 1
CAN Repeats 2
Viability sterile
Inserted Chromosome 3
Left Primer CGCGAATTCCAGATCGCGTTGGCACCACT
Right Primer CGCTCTAGAGCAGATTGAACGCCAGGAAGG
Template genomic
Sequence CAGATCGCGT TGGCACCACT GCCTTCTATC AAATCCAGCG CGGTTTGCTG GAACCGGTGG CCCTCTACTA TCCGGCCACG GATGCCCTGG ACTTCCGGTG TCCCCGCTGC CGGCCGGTGA AGTGGCACAG CGGGCAGGTA CCCATCGCCA AGCGGGTGTT CAAGCTGCGG GTGGCGACCA TCGCTCCACT GGCCTTCTAC ACCATCGCCA CCCTCTCCAG CGTGGGAATC GCTCTGGCCA TCGCCTTCCT GGCGTTCAAT CTGC